FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629711_at:

>probe:Drosophila_2:1629711_at:657:79; Interrogation_Position=167; Antisense; AGGTCTTTGTGTGCTTGTTGGCTTC
>probe:Drosophila_2:1629711_at:492:619; Interrogation_Position=178; Antisense; TGCTTGTTGGCTTCCCTGGCTCTGG
>probe:Drosophila_2:1629711_at:508:725; Interrogation_Position=299; Antisense; TTGGAGCTGGCCTGGTGTCCCACGT
>probe:Drosophila_2:1629711_at:717:597; Interrogation_Position=314; Antisense; TGTCCCACGTCTCGCAGTCGCAGGG
>probe:Drosophila_2:1629711_at:598:87; Interrogation_Position=329; Antisense; AGTCGCAGGGCAACACTAAGGTCCA
>probe:Drosophila_2:1629711_at:728:525; Interrogation_Position=336; Antisense; GGGCAACACTAAGGTCCACATTGGT
>probe:Drosophila_2:1629711_at:192:279; Interrogation_Position=344; Antisense; CTAAGGTCCACATTGGTGGTGGTTC
>probe:Drosophila_2:1629711_at:554:545; Interrogation_Position=418; Antisense; GGAGCTGGTGCTGCCTATGGAGGTG
>probe:Drosophila_2:1629711_at:400:669; Interrogation_Position=457; Antisense; TACGGCGGTGGTGCAGCCTCTTATG
>probe:Drosophila_2:1629711_at:318:617; Interrogation_Position=468; Antisense; TGCAGCCTCTTATGGCGGTGGACGC
>probe:Drosophila_2:1629711_at:682:437; Interrogation_Position=640; Antisense; GGTAACCCCGCTGAGTTCGATTACA
>probe:Drosophila_2:1629711_at:479:427; Interrogation_Position=652; Antisense; GAGTTCGATTACACTGTCAACCACG
>probe:Drosophila_2:1629711_at:319:599; Interrogation_Position=666; Antisense; TGTCAACCACGCTTCCGGAGGTGCT
>probe:Drosophila_2:1629711_at:529:289; Interrogation_Position=741; Antisense; CGGTGCCGGCTGGTGGAACGATTAA

Paste this into a BLAST search page for me
AGGTCTTTGTGTGCTTGTTGGCTTCTGCTTGTTGGCTTCCCTGGCTCTGGTTGGAGCTGGCCTGGTGTCCCACGTTGTCCCACGTCTCGCAGTCGCAGGGAGTCGCAGGGCAACACTAAGGTCCAGGGCAACACTAAGGTCCACATTGGTCTAAGGTCCACATTGGTGGTGGTTCGGAGCTGGTGCTGCCTATGGAGGTGTACGGCGGTGGTGCAGCCTCTTATGTGCAGCCTCTTATGGCGGTGGACGCGGTAACCCCGCTGAGTTCGATTACAGAGTTCGATTACACTGTCAACCACGTGTCAACCACGCTTCCGGAGGTGCTCGGTGCCGGCTGGTGGAACGATTAA

Full Affymetrix probeset data:

Annotations for 1629711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720