FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629713_at:

>probe:Drosophila_2:1629713_at:671:687; Interrogation_Position=143; Antisense; TATTCGAGGAGAACGTGGCCCAGGC
>probe:Drosophila_2:1629713_at:573:561; Interrogation_Position=239; Antisense; GGAACAAGAGGTGCCTGCTGGCCTA
>probe:Drosophila_2:1629713_at:108:623; Interrogation_Position=254; Antisense; TGCTGGCCTACCTATACGAGCGGTG
>probe:Drosophila_2:1629713_at:373:1; Interrogation_Position=286; Antisense; ATCAAGGCCCTCAGGTGGGAGTTTG
>probe:Drosophila_2:1629713_at:555:591; Interrogation_Position=301; Antisense; TGGGAGTTTGGACCCATTATCCCCG
>probe:Drosophila_2:1629713_at:620:47; Interrogation_Position=31; Antisense; ATGTTCGGCGAGAAAGCCTTCGACC
>probe:Drosophila_2:1629713_at:605:527; Interrogation_Position=326; Antisense; GGGACATCAAGCAGGCACTCTGCGA
>probe:Drosophila_2:1629713_at:705:71; Interrogation_Position=338; Antisense; AGGCACTCTGCGAACCGGAGGTCAC
>probe:Drosophila_2:1629713_at:651:435; Interrogation_Position=355; Antisense; GAGGTCACCTTCTTCAACAACTACT
>probe:Drosophila_2:1629713_at:501:627; Interrogation_Position=393; Antisense; TGCCTACATGTGCAGTGCGGGCTAC
>probe:Drosophila_2:1629713_at:126:85; Interrogation_Position=406; Antisense; AGTGCGGGCTACAACCAGGGCTTGC
>probe:Drosophila_2:1629713_at:380:391; Interrogation_Position=42; Antisense; GAAAGCCTTCGACCTGCTAAAAGAA
>probe:Drosophila_2:1629713_at:331:81; Interrogation_Position=422; Antisense; AGGGCTTGCCCATTGATCTAACCAA
>probe:Drosophila_2:1629713_at:336:101; Interrogation_Position=71; Antisense; AGAGATCGTCGCAGACAATTCCCGC

Paste this into a BLAST search page for me
TATTCGAGGAGAACGTGGCCCAGGCGGAACAAGAGGTGCCTGCTGGCCTATGCTGGCCTACCTATACGAGCGGTGATCAAGGCCCTCAGGTGGGAGTTTGTGGGAGTTTGGACCCATTATCCCCGATGTTCGGCGAGAAAGCCTTCGACCGGGACATCAAGCAGGCACTCTGCGAAGGCACTCTGCGAACCGGAGGTCACGAGGTCACCTTCTTCAACAACTACTTGCCTACATGTGCAGTGCGGGCTACAGTGCGGGCTACAACCAGGGCTTGCGAAAGCCTTCGACCTGCTAAAAGAAAGGGCTTGCCCATTGATCTAACCAAAGAGATCGTCGCAGACAATTCCCGC

Full Affymetrix probeset data:

Annotations for 1629713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720