FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629715_at:

>probe:Drosophila_2:1629715_at:463:591; Interrogation_Position=324; Antisense; TGTGGGACATCGGAGGCCAACCTCG
>probe:Drosophila_2:1629715_at:605:463; Interrogation_Position=348; Antisense; GATTCCGATCCATGTGGGAGCGCTA
>probe:Drosophila_2:1629715_at:425:553; Interrogation_Position=364; Antisense; GGAGCGCTATTGTCGCGGCGTTAAT
>probe:Drosophila_2:1629715_at:38:599; Interrogation_Position=394; Antisense; TGTCTACATGGTGGACGCAGCCGAT
>probe:Drosophila_2:1629715_at:127:419; Interrogation_Position=446; Antisense; GAGCTGCACTCACTGTTGGACAAAC
>probe:Drosophila_2:1629715_at:629:629; Interrogation_Position=487; Antisense; TCCAGTTCTCGTGCTGGGCAATAAA
>probe:Drosophila_2:1629715_at:395:31; Interrogation_Position=507; Antisense; ATAAACGAGATCTTCCAGGCGCTCT
>probe:Drosophila_2:1629715_at:643:69; Interrogation_Position=523; Antisense; AGGCGCTCTCGATGAAACCGGACTC
>probe:Drosophila_2:1629715_at:618:365; Interrogation_Position=559; Antisense; GAATCTATCGAGCATACAGGACCGT
>probe:Drosophila_2:1629715_at:330:73; Interrogation_Position=576; Antisense; AGGACCGTGAAATCTGCTGTTATAG
>probe:Drosophila_2:1629715_at:125:335; Interrogation_Position=591; Antisense; GCTGTTATAGTATTTCCTGCAAGGA
>probe:Drosophila_2:1629715_at:522:559; Interrogation_Position=619; Antisense; GGACAACATTGACATCACGCTGCAG
>probe:Drosophila_2:1629715_at:449:149; Interrogation_Position=728; Antisense; ACTTAGGCACTATATCTCACACATA
>probe:Drosophila_2:1629715_at:231:343; Interrogation_Position=797; Antisense; GCTTATATGCTTCGATGCGGATTAT

Paste this into a BLAST search page for me
TGTGGGACATCGGAGGCCAACCTCGGATTCCGATCCATGTGGGAGCGCTAGGAGCGCTATTGTCGCGGCGTTAATTGTCTACATGGTGGACGCAGCCGATGAGCTGCACTCACTGTTGGACAAACTCCAGTTCTCGTGCTGGGCAATAAAATAAACGAGATCTTCCAGGCGCTCTAGGCGCTCTCGATGAAACCGGACTCGAATCTATCGAGCATACAGGACCGTAGGACCGTGAAATCTGCTGTTATAGGCTGTTATAGTATTTCCTGCAAGGAGGACAACATTGACATCACGCTGCAGACTTAGGCACTATATCTCACACATAGCTTATATGCTTCGATGCGGATTAT

Full Affymetrix probeset data:

Annotations for 1629715_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720