FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629717_at:

>probe:Drosophila_2:1629717_at:292:681; Interrogation_Position=1017; Antisense; TAGGCATCACAAACGCGATCGCAAT
>probe:Drosophila_2:1629717_at:419:503; Interrogation_Position=1122; Antisense; GTGGGCGTTTCTCCTAGTAACCGCA
>probe:Drosophila_2:1629717_at:496:89; Interrogation_Position=1137; Antisense; AGTAACCGCAGTCCGATTTGTATTT
>probe:Drosophila_2:1629717_at:7:21; Interrogation_Position=1158; Antisense; ATTTGTATTTGCACCAAAGCGCCAA
>probe:Drosophila_2:1629717_at:513:595; Interrogation_Position=1205; Antisense; TGTGTGTTTTTTCGTTCGCCGCCAA
>probe:Drosophila_2:1629717_at:271:181; Interrogation_Position=1239; Antisense; AAAAATGCCAGCGATCGGCCACAAC
>probe:Drosophila_2:1629717_at:519:455; Interrogation_Position=1279; Antisense; GATAATGTTTGTGTGTCGTGCTTGT
>probe:Drosophila_2:1629717_at:197:107; Interrogation_Position=715; Antisense; AGAAAATCTCGACCGCAGCTAGCAA
>probe:Drosophila_2:1629717_at:249:331; Interrogation_Position=732; Antisense; GCTAGCAAACGTTGGCGTTGGCCCT
>probe:Drosophila_2:1629717_at:502:301; Interrogation_Position=753; Antisense; CCCTCGGCGACTATTATTACTACAT
>probe:Drosophila_2:1629717_at:181:15; Interrogation_Position=768; Antisense; ATTACTACATTTACGACCCTGCAGT
>probe:Drosophila_2:1629717_at:393:263; Interrogation_Position=881; Antisense; CAGCGGCTGACTGGCGGTGTCTAAA
>probe:Drosophila_2:1629717_at:500:43; Interrogation_Position=924; Antisense; ATCGCATCACAACATCGGTGCAAGT
>probe:Drosophila_2:1629717_at:379:365; Interrogation_Position=949; Antisense; GAATCTGCTTATCACAATCGCAGCA

Paste this into a BLAST search page for me
TAGGCATCACAAACGCGATCGCAATGTGGGCGTTTCTCCTAGTAACCGCAAGTAACCGCAGTCCGATTTGTATTTATTTGTATTTGCACCAAAGCGCCAATGTGTGTTTTTTCGTTCGCCGCCAAAAAAATGCCAGCGATCGGCCACAACGATAATGTTTGTGTGTCGTGCTTGTAGAAAATCTCGACCGCAGCTAGCAAGCTAGCAAACGTTGGCGTTGGCCCTCCCTCGGCGACTATTATTACTACATATTACTACATTTACGACCCTGCAGTCAGCGGCTGACTGGCGGTGTCTAAAATCGCATCACAACATCGGTGCAAGTGAATCTGCTTATCACAATCGCAGCA

Full Affymetrix probeset data:

Annotations for 1629717_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720