FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629723_at:

>probe:Drosophila_2:1629723_at:618:339; Interrogation_Position=233; Antisense; GCTATGGCGATTACCAGGTGACCCT
>probe:Drosophila_2:1629723_at:300:81; Interrogation_Position=248; Antisense; AGGTGACCCTCAAGCATCGCGAAGT
>probe:Drosophila_2:1629723_at:647:45; Interrogation_Position=284; Antisense; ATGCCATTTCCACATTGGTTCTGAA
>probe:Drosophila_2:1629723_at:505:339; Interrogation_Position=336; Antisense; GCTCACCCACTACTGGTACAAATGG
>probe:Drosophila_2:1629723_at:442:615; Interrogation_Position=428; Antisense; TGAAGTCCTACTCCCTTGAGCAGGC
>probe:Drosophila_2:1629723_at:653:421; Interrogation_Position=466; Antisense; GAGAAGTCCGCGACCCTGGAGACGT
>probe:Drosophila_2:1629723_at:260:113; Interrogation_Position=526; Antisense; AGCACGTCCAGCCACGAGATTAATG
>probe:Drosophila_2:1629723_at:305:209; Interrogation_Position=579; Antisense; AAGTCAGCAGGGACCGCTAACCGTT
>probe:Drosophila_2:1629723_at:393:317; Interrogation_Position=617; Antisense; GCACGGGACGAACCGGTACCATTAT
>probe:Drosophila_2:1629723_at:407:15; Interrogation_Position=637; Antisense; ATTATAGCGTCGGACATGGCCATCC
>probe:Drosophila_2:1629723_at:398:69; Interrogation_Position=652; Antisense; ATGGCCATCCGCAGTCTGGAAACAC
>probe:Drosophila_2:1629723_at:53:195; Interrogation_Position=701; Antisense; AACTGGTTTACTACGTGCGACGCGG
>probe:Drosophila_2:1629723_at:671:505; Interrogation_Position=728; Antisense; GTGCCAGCGCCGTACAGACCAAGGA
>probe:Drosophila_2:1629723_at:657:363; Interrogation_Position=760; Antisense; GAATTTATCTACAAGGTGGCCAGCA

Paste this into a BLAST search page for me
GCTATGGCGATTACCAGGTGACCCTAGGTGACCCTCAAGCATCGCGAAGTATGCCATTTCCACATTGGTTCTGAAGCTCACCCACTACTGGTACAAATGGTGAAGTCCTACTCCCTTGAGCAGGCGAGAAGTCCGCGACCCTGGAGACGTAGCACGTCCAGCCACGAGATTAATGAAGTCAGCAGGGACCGCTAACCGTTGCACGGGACGAACCGGTACCATTATATTATAGCGTCGGACATGGCCATCCATGGCCATCCGCAGTCTGGAAACACAACTGGTTTACTACGTGCGACGCGGGTGCCAGCGCCGTACAGACCAAGGAGAATTTATCTACAAGGTGGCCAGCA

Full Affymetrix probeset data:

Annotations for 1629723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720