FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629725_at:

>probe:Drosophila_2:1629725_at:190:495; Interrogation_Position=1028; Antisense; GTCAACGACATTGTGTGGCGCAGCA
>probe:Drosophila_2:1629725_at:423:507; Interrogation_Position=1083; Antisense; GTGCTGGCATTCTCAAGTCATTGGC
>probe:Drosophila_2:1629725_at:301:575; Interrogation_Position=1105; Antisense; GGCGTATAGCTATCGCAAGGCTCAA
>probe:Drosophila_2:1629725_at:605:587; Interrogation_Position=549; Antisense; TGGTCAATCCTTCTGATAATCCTCC
>probe:Drosophila_2:1629725_at:88:101; Interrogation_Position=591; Antisense; AGAGGAATCTTGTATCCGCGCTGCA
>probe:Drosophila_2:1629725_at:342:221; Interrogation_Position=615; Antisense; AAGTGGCTCTGCTACTTTTACCAGA
>probe:Drosophila_2:1629725_at:159:99; Interrogation_Position=637; Antisense; AGAGAAGTTCACTGCCTACGGACTT
>probe:Drosophila_2:1629725_at:172:129; Interrogation_Position=668; Antisense; ACCATCGCCGGACTGAGTTACAAGG
>probe:Drosophila_2:1629725_at:468:251; Interrogation_Position=688; Antisense; CAAGGGCGATTTCCGTATGATTTTC
>probe:Drosophila_2:1629725_at:166:593; Interrogation_Position=789; Antisense; TGGGACAACTTTCCGACTATGTGGC
>probe:Drosophila_2:1629725_at:411:553; Interrogation_Position=840; Antisense; GGAGCCGGAAACCAGCCATAATCTT
>probe:Drosophila_2:1629725_at:213:73; Interrogation_Position=870; Antisense; AGGACAAATCCTCATCGGCTACATG
>probe:Drosophila_2:1629725_at:4:141; Interrogation_Position=907; Antisense; ACAGTTGCCCCGAGAGCTTCAGAAG
>probe:Drosophila_2:1629725_at:519:517; Interrogation_Position=974; Antisense; GTGGTGAATCACCTATCCATGGCCT

Paste this into a BLAST search page for me
GTCAACGACATTGTGTGGCGCAGCAGTGCTGGCATTCTCAAGTCATTGGCGGCGTATAGCTATCGCAAGGCTCAATGGTCAATCCTTCTGATAATCCTCCAGAGGAATCTTGTATCCGCGCTGCAAAGTGGCTCTGCTACTTTTACCAGAAGAGAAGTTCACTGCCTACGGACTTACCATCGCCGGACTGAGTTACAAGGCAAGGGCGATTTCCGTATGATTTTCTGGGACAACTTTCCGACTATGTGGCGGAGCCGGAAACCAGCCATAATCTTAGGACAAATCCTCATCGGCTACATGACAGTTGCCCCGAGAGCTTCAGAAGGTGGTGAATCACCTATCCATGGCCT

Full Affymetrix probeset data:

Annotations for 1629725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720