FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629726_at:

>probe:Drosophila_2:1629726_at:689:263; Interrogation_Position=371; Antisense; CAGCAGATCATCTTCGTGGAGACAA
>probe:Drosophila_2:1629726_at:708:137; Interrogation_Position=411; Antisense; ACGAGGATTGGATCGCCGAGACCAT
>probe:Drosophila_2:1629726_at:464:19; Interrogation_Position=446; Antisense; ATTTCCCTGATCAAGTTGCCAGTGC
>probe:Drosophila_2:1629726_at:77:721; Interrogation_Position=461; Antisense; TTGCCAGTGCCCATTGAGTTCAACA
>probe:Drosophila_2:1629726_at:514:429; Interrogation_Position=476; Antisense; GAGTTCAACAAGTACATCCAGCCCG
>probe:Drosophila_2:1629726_at:283:623; Interrogation_Position=507; Antisense; TGCCCGTGAAATCCGACAGCTACAG
>probe:Drosophila_2:1629726_at:687:155; Interrogation_Position=522; Antisense; ACAGCTACAGCACCTACGGCGGAGA
>probe:Drosophila_2:1629726_at:11:427; Interrogation_Position=543; Antisense; GAGAGAATGCCATTGCCTCCGGATG
>probe:Drosophila_2:1629726_at:174:215; Interrogation_Position=572; Antisense; AAGATCAGCGACTCTGCTACCGGAG
>probe:Drosophila_2:1629726_at:508:289; Interrogation_Position=592; Antisense; CGGAGCGACCGACATTTTGCAGTAC
>probe:Drosophila_2:1629726_at:449:89; Interrogation_Position=612; Antisense; AGTACGCTACGGTTCCCATCATGAA
>probe:Drosophila_2:1629726_at:730:693; Interrogation_Position=687; Antisense; TTTGCATCAAGACCACCGGCGGAAT
>probe:Drosophila_2:1629726_at:429:277; Interrogation_Position=741; Antisense; CTTTGGTCCTGGATGACGGCAGCAA
>probe:Drosophila_2:1629726_at:570:567; Interrogation_Position=758; Antisense; GGCAGCAACACCCTGATTGGAGCCA

Paste this into a BLAST search page for me
CAGCAGATCATCTTCGTGGAGACAAACGAGGATTGGATCGCCGAGACCATATTTCCCTGATCAAGTTGCCAGTGCTTGCCAGTGCCCATTGAGTTCAACAGAGTTCAACAAGTACATCCAGCCCGTGCCCGTGAAATCCGACAGCTACAGACAGCTACAGCACCTACGGCGGAGAGAGAGAATGCCATTGCCTCCGGATGAAGATCAGCGACTCTGCTACCGGAGCGGAGCGACCGACATTTTGCAGTACAGTACGCTACGGTTCCCATCATGAATTTGCATCAAGACCACCGGCGGAATCTTTGGTCCTGGATGACGGCAGCAAGGCAGCAACACCCTGATTGGAGCCA

Full Affymetrix probeset data:

Annotations for 1629726_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720