FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629727_at:

>probe:Drosophila_2:1629727_at:239:339; Interrogation_Position=200; Antisense; GCTACAATGCCGTGGGATCCTTTGA
>probe:Drosophila_2:1629727_at:644:425; Interrogation_Position=240; Antisense; GAGAGTGAAATTTACCCAGGATGCC
>probe:Drosophila_2:1629727_at:574:535; Interrogation_Position=269; Antisense; GGTCTATAGCTATCAATGCCGATCT
>probe:Drosophila_2:1629727_at:386:529; Interrogation_Position=347; Antisense; GGGATCCAAATCACTATGTAGCCAG
>probe:Drosophila_2:1629727_at:173:75; Interrogation_Position=370; Antisense; AGGACTTTGATTTCCGTGCCCAAGT
>probe:Drosophila_2:1629727_at:28:323; Interrogation_Position=387; Antisense; GCCCAAGTTGCGTTTCAATTTCGAT
>probe:Drosophila_2:1629727_at:503:169; Interrogation_Position=421; Antisense; AAAGGACACGTCTCAGCGCTGAATC
>probe:Drosophila_2:1629727_at:486:363; Interrogation_Position=499; Antisense; GAATTGGCTGTCAAACCGCTGGCCA
>probe:Drosophila_2:1629727_at:511:313; Interrogation_Position=520; Antisense; GCCACCTCAGATGGTTATTTCGCTG
>probe:Drosophila_2:1629727_at:589:17; Interrogation_Position=566; Antisense; ATTTCCGCGAGATCAAGCAATTCCG
>probe:Drosophila_2:1629727_at:365:119; Interrogation_Position=596; Antisense; AGCTGGAAAATCTCTTTGGCGGCAA
>probe:Drosophila_2:1629727_at:56:453; Interrogation_Position=625; Antisense; GATCTGGAGGATACTGCACACATTT
>probe:Drosophila_2:1629727_at:676:195; Interrogation_Position=661; Antisense; AACTGGCGCGACTTCTTTGAGGTAC
>probe:Drosophila_2:1629727_at:315:103; Interrogation_Position=740; Antisense; AGACCTTTGTCTATGTACCAGCTAC

Paste this into a BLAST search page for me
GCTACAATGCCGTGGGATCCTTTGAGAGAGTGAAATTTACCCAGGATGCCGGTCTATAGCTATCAATGCCGATCTGGGATCCAAATCACTATGTAGCCAGAGGACTTTGATTTCCGTGCCCAAGTGCCCAAGTTGCGTTTCAATTTCGATAAAGGACACGTCTCAGCGCTGAATCGAATTGGCTGTCAAACCGCTGGCCAGCCACCTCAGATGGTTATTTCGCTGATTTCCGCGAGATCAAGCAATTCCGAGCTGGAAAATCTCTTTGGCGGCAAGATCTGGAGGATACTGCACACATTTAACTGGCGCGACTTCTTTGAGGTACAGACCTTTGTCTATGTACCAGCTAC

Full Affymetrix probeset data:

Annotations for 1629727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720