FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629729_at:

>probe:Drosophila_2:1629729_at:467:571; Interrogation_Position=1396; Antisense; GGCTATTACCGCGTGGGCAGGAATC
>probe:Drosophila_2:1629729_at:72:41; Interrogation_Position=1418; Antisense; ATCTGGCCAGGACTTTGCTTCAGTA
>probe:Drosophila_2:1629729_at:433:343; Interrogation_Position=1434; Antisense; GCTTCAGTACTATCGCTTCATTAAC
>probe:Drosophila_2:1629729_at:373:625; Interrogation_Position=1463; Antisense; TGCCCATGCCGATTGTGACAGAGGT
>probe:Drosophila_2:1629729_at:405:301; Interrogation_Position=1539; Antisense; GTCGAAAACCCGCTACGAGGTGAAG
>probe:Drosophila_2:1629729_at:115:299; Interrogation_Position=1594; Antisense; CCCATTGCCTACACAAACCTAAGTA
>probe:Drosophila_2:1629729_at:47:503; Interrogation_Position=1679; Antisense; GTCCCTTGGCTCCTGGAAGCAGTTG
>probe:Drosophila_2:1629729_at:648:113; Interrogation_Position=1696; Antisense; AGCAGTTGCTTTAGCGGGTACCGCA
>probe:Drosophila_2:1629729_at:573:695; Interrogation_Position=1783; Antisense; TTCGCACTGGGTGCCCTGAAAACGG
>probe:Drosophila_2:1629729_at:585:727; Interrogation_Position=1829; Antisense; TTGGTGGCTCCAAGGGCAAGCGATC
>probe:Drosophila_2:1629729_at:396:35; Interrogation_Position=1851; Antisense; ATCAGCAGCGGTCACCATCGAAGTT
>probe:Drosophila_2:1629729_at:233:205; Interrogation_Position=1900; Antisense; AAGCCTTATCTGTCCATCATCGACT
>probe:Drosophila_2:1629729_at:518:377; Interrogation_Position=1943; Antisense; GAAGCCTTAAGCTGAAGTCCAATAG
>probe:Drosophila_2:1629729_at:629:241; Interrogation_Position=1963; Antisense; AATAGCTTCGATGCCGCAGACAGGA

Paste this into a BLAST search page for me
GGCTATTACCGCGTGGGCAGGAATCATCTGGCCAGGACTTTGCTTCAGTAGCTTCAGTACTATCGCTTCATTAACTGCCCATGCCGATTGTGACAGAGGTGTCGAAAACCCGCTACGAGGTGAAGCCCATTGCCTACACAAACCTAAGTAGTCCCTTGGCTCCTGGAAGCAGTTGAGCAGTTGCTTTAGCGGGTACCGCATTCGCACTGGGTGCCCTGAAAACGGTTGGTGGCTCCAAGGGCAAGCGATCATCAGCAGCGGTCACCATCGAAGTTAAGCCTTATCTGTCCATCATCGACTGAAGCCTTAAGCTGAAGTCCAATAGAATAGCTTCGATGCCGCAGACAGGA

Full Affymetrix probeset data:

Annotations for 1629729_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720