FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629730_at:

>probe:Drosophila_2:1629730_at:401:295; Interrogation_Position=114; Antisense; CGAAATGAAGCTATCCGAGGGAGTT
>probe:Drosophila_2:1629730_at:554:459; Interrogation_Position=152; Antisense; GATTTGTGGTTGGAGTCGTCCAGAC
>probe:Drosophila_2:1629730_at:324:65; Interrogation_Position=165; Antisense; AGTCGTCCAGACTGGATTCCACTGG
>probe:Drosophila_2:1629730_at:403:463; Interrogation_Position=191; Antisense; GATTCGTGCCTCTTGTGCTGTATTT
>probe:Drosophila_2:1629730_at:244:699; Interrogation_Position=220; Antisense; TTTATGAAGGGAGCTGAGCCTGGCA
>probe:Drosophila_2:1629730_at:244:381; Interrogation_Position=255; Antisense; GAACCTTTTCAGTCTGTTATGGCAG
>probe:Drosophila_2:1629730_at:469:605; Interrogation_Position=295; Antisense; TGATCATTTTGCTGTCGTATGCCCC
>probe:Drosophila_2:1629730_at:506:85; Interrogation_Position=31; Antisense; AGTGCTGTTTTCCAACACTTCGTTT
>probe:Drosophila_2:1629730_at:667:483; Interrogation_Position=311; Antisense; GTATGCCCCGCATTTTGGTTCTGGT
>probe:Drosophila_2:1629730_at:59:341; Interrogation_Position=320; Antisense; GCATTTTGGTTCTGGTTGGGTTTCT
>probe:Drosophila_2:1629730_at:552:713; Interrogation_Position=341; Antisense; TTCTGGGAACGGGTGCAGTACCTGC
>probe:Drosophila_2:1629730_at:29:511; Interrogation_Position=353; Antisense; GTGCAGTACCTGCAGCTATTGCAAA
>probe:Drosophila_2:1629730_at:509:187; Interrogation_Position=44; Antisense; AACACTTCGTTTGCAGTCAGACAAG
>probe:Drosophila_2:1629730_at:410:419; Interrogation_Position=93; Antisense; GAGCTAAATTCAATATCCGTACGAA

Paste this into a BLAST search page for me
CGAAATGAAGCTATCCGAGGGAGTTGATTTGTGGTTGGAGTCGTCCAGACAGTCGTCCAGACTGGATTCCACTGGGATTCGTGCCTCTTGTGCTGTATTTTTTATGAAGGGAGCTGAGCCTGGCAGAACCTTTTCAGTCTGTTATGGCAGTGATCATTTTGCTGTCGTATGCCCCAGTGCTGTTTTCCAACACTTCGTTTGTATGCCCCGCATTTTGGTTCTGGTGCATTTTGGTTCTGGTTGGGTTTCTTTCTGGGAACGGGTGCAGTACCTGCGTGCAGTACCTGCAGCTATTGCAAAAACACTTCGTTTGCAGTCAGACAAGGAGCTAAATTCAATATCCGTACGAA

Full Affymetrix probeset data:

Annotations for 1629730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720