FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629731_at:

>probe:Drosophila_2:1629731_at:276:435; Interrogation_Position=454; Antisense; GAGGAGGGCGTCACCCCTGAAAGTT
>probe:Drosophila_2:1629731_at:399:393; Interrogation_Position=472; Antisense; GAAAGTTCAACCACAGAGAGCAGCA
>probe:Drosophila_2:1629731_at:630:143; Interrogation_Position=499; Antisense; ACTGCGGCCACTACCAAACTGTTTG
>probe:Drosophila_2:1629731_at:444:177; Interrogation_Position=514; Antisense; AAACTGTTTGCCATCGACGCCAGTT
>probe:Drosophila_2:1629731_at:54:233; Interrogation_Position=598; Antisense; AATGCAACGCTATCGATTGCCGAGC
>probe:Drosophila_2:1629731_at:62:91; Interrogation_Position=686; Antisense; AGTACGTGCTAGTAGATGGCGGCCA
>probe:Drosophila_2:1629731_at:391:117; Interrogation_Position=736; Antisense; AGCTTCACTCACATCGGCAGCGATG
>probe:Drosophila_2:1629731_at:176:127; Interrogation_Position=770; Antisense; AGCCTGTTGTGCACTCCGTCGAAAT
>probe:Drosophila_2:1629731_at:601:261; Interrogation_Position=801; Antisense; CACCAGCTTCGATGATCCTTTGATT
>probe:Drosophila_2:1629731_at:715:245; Interrogation_Position=829; Antisense; AATTACGTGCACAATTTGCGCTGAC
>probe:Drosophila_2:1629731_at:535:611; Interrogation_Position=850; Antisense; TGACTTTCCCAAGGAGGCGTGCCAG
>probe:Drosophila_2:1629731_at:452:555; Interrogation_Position=874; Antisense; GGACGAATCAATTAACCCGGCGCGA
>probe:Drosophila_2:1629731_at:141:655; Interrogation_Position=930; Antisense; TAACTCCTTTTGTTACCTCTTCAAT
>probe:Drosophila_2:1629731_at:552:683; Interrogation_Position=960; Antisense; TATCGAATGGCTTGATGACTGGCAT

Paste this into a BLAST search page for me
GAGGAGGGCGTCACCCCTGAAAGTTGAAAGTTCAACCACAGAGAGCAGCAACTGCGGCCACTACCAAACTGTTTGAAACTGTTTGCCATCGACGCCAGTTAATGCAACGCTATCGATTGCCGAGCAGTACGTGCTAGTAGATGGCGGCCAAGCTTCACTCACATCGGCAGCGATGAGCCTGTTGTGCACTCCGTCGAAATCACCAGCTTCGATGATCCTTTGATTAATTACGTGCACAATTTGCGCTGACTGACTTTCCCAAGGAGGCGTGCCAGGGACGAATCAATTAACCCGGCGCGATAACTCCTTTTGTTACCTCTTCAATTATCGAATGGCTTGATGACTGGCAT

Full Affymetrix probeset data:

Annotations for 1629731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720