FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629732_at:

>probe:Drosophila_2:1629732_at:455:85; Interrogation_Position=1258; Antisense; AGTGACCTCCATAATAGCTCCTTTG
>probe:Drosophila_2:1629732_at:502:77; Interrogation_Position=1308; Antisense; AGGAGGATCCCAGCCAGTGGCGCAT
>probe:Drosophila_2:1629732_at:509:267; Interrogation_Position=1322; Antisense; CAGTGGCGCATGGTATTCTTTATTA
>probe:Drosophila_2:1629732_at:521:79; Interrogation_Position=1351; Antisense; AGGTATTTACCTAGTGTGCAACACA
>probe:Drosophila_2:1629732_at:534:725; Interrogation_Position=1389; Antisense; TTGGCAAGGCCACTATTCAGATTTG
>probe:Drosophila_2:1629732_at:408:19; Interrogation_Position=1409; Antisense; ATTTGGAACGAACCTCCATCGACGT
>probe:Drosophila_2:1629732_at:86:459; Interrogation_Position=1469; Antisense; GATTCAAAGTCCATTGTTCCCACGT
>probe:Drosophila_2:1629732_at:192:211; Interrogation_Position=1500; Antisense; AAGACATTCGGTACTAAGCCCTCGA
>probe:Drosophila_2:1629732_at:50:355; Interrogation_Position=1528; Antisense; GCACCTGGACGCCATGTACATACAT
>probe:Drosophila_2:1629732_at:1:705; Interrogation_Position=1584; Antisense; TTATTTAAGCTTGCCGCTGTGACAG
>probe:Drosophila_2:1629732_at:652:399; Interrogation_Position=1604; Antisense; GACAGCGTTATTTGGATATGCCTAG
>probe:Drosophila_2:1629732_at:609:55; Interrogation_Position=1711; Antisense; ATGACTTTACTATGTGTGGCACGTT
>probe:Drosophila_2:1629732_at:176:521; Interrogation_Position=1726; Antisense; GTGGCACGTTTCGAAGCTGCTGAAG
>probe:Drosophila_2:1629732_at:453:665; Interrogation_Position=1809; Antisense; TACAATCCTGTGTCATCGCTAAAAT

Paste this into a BLAST search page for me
AGTGACCTCCATAATAGCTCCTTTGAGGAGGATCCCAGCCAGTGGCGCATCAGTGGCGCATGGTATTCTTTATTAAGGTATTTACCTAGTGTGCAACACATTGGCAAGGCCACTATTCAGATTTGATTTGGAACGAACCTCCATCGACGTGATTCAAAGTCCATTGTTCCCACGTAAGACATTCGGTACTAAGCCCTCGAGCACCTGGACGCCATGTACATACATTTATTTAAGCTTGCCGCTGTGACAGGACAGCGTTATTTGGATATGCCTAGATGACTTTACTATGTGTGGCACGTTGTGGCACGTTTCGAAGCTGCTGAAGTACAATCCTGTGTCATCGCTAAAAT

Full Affymetrix probeset data:

Annotations for 1629732_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720