Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629733_at:

>probe:Drosophila_2:1629733_at:701:601; Interrogation_Position=2518; Antisense; TGTATTTCAATTCGGCGCCAAAATA
>probe:Drosophila_2:1629733_at:170:673; Interrogation_Position=2584; Antisense; TAGACAAAGGAAATCTCTCTTAAAT
>probe:Drosophila_2:1629733_at:493:185; Interrogation_Position=2614; Antisense; AAAATCAAATAATGGGCGCTGCACA
>probe:Drosophila_2:1629733_at:470:523; Interrogation_Position=2627; Antisense; GGGCGCTGCACATAGTAAACAATTT
>probe:Drosophila_2:1629733_at:651:131; Interrogation_Position=2711; Antisense; ACCCAAACACTAAACGTCTTGTCTG
>probe:Drosophila_2:1629733_at:259:259; Interrogation_Position=2718; Antisense; CACTAAACGTCTTGTCTGTAATTAA
>probe:Drosophila_2:1629733_at:37:113; Interrogation_Position=2844; Antisense; AGCACATTTTATTCGTATATCTAAA
>probe:Drosophila_2:1629733_at:41:245; Interrogation_Position=2868; Antisense; AATTTGTTTATTTTTGCCTGCATTT
>probe:Drosophila_2:1629733_at:714:699; Interrogation_Position=2878; Antisense; TTTTTGCCTGCATTTTTTGACGAAA
>probe:Drosophila_2:1629733_at:315:491; Interrogation_Position=2977; Antisense; GTAACTAGGCATGTACTAGCTCCTA
>probe:Drosophila_2:1629733_at:162:569; Interrogation_Position=2984; Antisense; GGCATGTACTAGCTCCTAAGTCTAC
>probe:Drosophila_2:1629733_at:422:337; Interrogation_Position=2995; Antisense; GCTCCTAAGTCTACATAAACCAGAT
>probe:Drosophila_2:1629733_at:168:213; Interrogation_Position=3031; Antisense; AAGAGCTACATACGGCAGCACACAC
>probe:Drosophila_2:1629733_at:546:351; Interrogation_Position=3045; Antisense; GCAGCACACACGTACACGGCAAAAA

Paste this into a BLAST search page for me
TGTATTTCAATTCGGCGCCAAAATATAGACAAAGGAAATCTCTCTTAAATAAAATCAAATAATGGGCGCTGCACAGGGCGCTGCACATAGTAAACAATTTACCCAAACACTAAACGTCTTGTCTGCACTAAACGTCTTGTCTGTAATTAAAGCACATTTTATTCGTATATCTAAAAATTTGTTTATTTTTGCCTGCATTTTTTTTGCCTGCATTTTTTGACGAAAGTAACTAGGCATGTACTAGCTCCTAGGCATGTACTAGCTCCTAAGTCTACGCTCCTAAGTCTACATAAACCAGATAAGAGCTACATACGGCAGCACACACGCAGCACACACGTACACGGCAAAAA

Full Affymetrix probeset data:

Annotations for 1629733_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime