Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629737_at:

>probe:Drosophila_2:1629737_at:104:207; Interrogation_Position=2232; Antisense; AAGCGCAACAACGACTCATTCAGGC
>probe:Drosophila_2:1629737_at:125:13; Interrogation_Position=2249; Antisense; ATTCAGGCCTACGTGGACATGCGAA
>probe:Drosophila_2:1629737_at:99:589; Interrogation_Position=2319; Antisense; TGGAGAGTCTCATCCGACTGTCGGA
>probe:Drosophila_2:1629737_at:349:507; Interrogation_Position=2357; Antisense; GTGCGTCTCAGCAACCAGGTGGAAT
>probe:Drosophila_2:1629737_at:555:305; Interrogation_Position=2451; Antisense; CCGGCAAAATTGACGTGGGCATTCT
>probe:Drosophila_2:1629737_at:474:571; Interrogation_Position=2483; Antisense; GGCTTATCAACAGCCGCTCGCAAAA
>probe:Drosophila_2:1629737_at:431:181; Interrogation_Position=2504; Antisense; AAAAAGCGCGCCGATCTGGTGGCAG
>probe:Drosophila_2:1629737_at:535:521; Interrogation_Position=2522; Antisense; GTGGCAGCCATCAAGGAAAACCTCA
>probe:Drosophila_2:1629737_at:549:171; Interrogation_Position=2558; Antisense; AAAGTTCTCACAGTTCCCTATCAGA
>probe:Drosophila_2:1629737_at:443:15; Interrogation_Position=2615; Antisense; ATTATGATCACACGCGAGCAATTTG
>probe:Drosophila_2:1629737_at:62:83; Interrogation_Position=2667; Antisense; AGGGCGCAATTGTTGTCATGGGAAA
>probe:Drosophila_2:1629737_at:331:705; Interrogation_Position=2725; Antisense; TTATCTCATTCAAAACCAACCGCAA
>probe:Drosophila_2:1629737_at:252:309; Interrogation_Position=2740; Antisense; CCAACCGCAAATTCATTCATTCCTA
>probe:Drosophila_2:1629737_at:40:647; Interrogation_Position=2756; Antisense; TCATTCCTATTTTTAAGCGCAACTA

Paste this into a BLAST search page for me
AAGCGCAACAACGACTCATTCAGGCATTCAGGCCTACGTGGACATGCGAATGGAGAGTCTCATCCGACTGTCGGAGTGCGTCTCAGCAACCAGGTGGAATCCGGCAAAATTGACGTGGGCATTCTGGCTTATCAACAGCCGCTCGCAAAAAAAAAGCGCGCCGATCTGGTGGCAGGTGGCAGCCATCAAGGAAAACCTCAAAAGTTCTCACAGTTCCCTATCAGAATTATGATCACACGCGAGCAATTTGAGGGCGCAATTGTTGTCATGGGAAATTATCTCATTCAAAACCAACCGCAACCAACCGCAAATTCATTCATTCCTATCATTCCTATTTTTAAGCGCAACTA

Full Affymetrix probeset data:

Annotations for 1629737_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime