FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629738_at:

>probe:Drosophila_2:1629738_at:485:71; Interrogation_Position=116; Antisense; AGGCGTGTCAGAATGTGGATAAATC
>probe:Drosophila_2:1629738_at:295:27; Interrogation_Position=148; Antisense; ATAGCGAACCAGAATGACTCCACAT
>probe:Drosophila_2:1629738_at:621:109; Interrogation_Position=158; Antisense; AGAATGACTCCACATGCGTCAGCTA
>probe:Drosophila_2:1629738_at:217:557; Interrogation_Position=17; Antisense; GGACGAGTCTAATTGTATCACTGCT
>probe:Drosophila_2:1629738_at:339:329; Interrogation_Position=173; Antisense; GCGTCAGCTACGTCTATTGTTATAA
>probe:Drosophila_2:1629738_at:275:89; Interrogation_Position=198; Antisense; AGTCAATGACTCAACGAGGGCTCTA
>probe:Drosophila_2:1629738_at:677:293; Interrogation_Position=212; Antisense; CGAGGGCTCTAATCAAAAGCTGCAA
>probe:Drosophila_2:1629738_at:359:173; Interrogation_Position=227; Antisense; AAAGCTGCAAGACCGGGCAATTCTT
>probe:Drosophila_2:1629738_at:639:565; Interrogation_Position=242; Antisense; GGCAATTCTTTGATGCCGATCTCAA
>probe:Drosophila_2:1629738_at:131:319; Interrogation_Position=256; Antisense; GCCGATCTCAAATTCTGCACTATCA
>probe:Drosophila_2:1629738_at:235:655; Interrogation_Position=26; Antisense; TAATTGTATCACTGCTCCTGGTCCA
>probe:Drosophila_2:1629738_at:441:617; Interrogation_Position=271; Antisense; TGCACTATCAGCAAACCAGCGGGAT
>probe:Drosophila_2:1629738_at:161:303; Interrogation_Position=68; Antisense; CCGCGCCTGCGCTAAAGGATCTGGA
>probe:Drosophila_2:1629738_at:676:663; Interrogation_Position=80; Antisense; TAAAGGATCTGGACGCGGGCACCTG

Paste this into a BLAST search page for me
AGGCGTGTCAGAATGTGGATAAATCATAGCGAACCAGAATGACTCCACATAGAATGACTCCACATGCGTCAGCTAGGACGAGTCTAATTGTATCACTGCTGCGTCAGCTACGTCTATTGTTATAAAGTCAATGACTCAACGAGGGCTCTACGAGGGCTCTAATCAAAAGCTGCAAAAAGCTGCAAGACCGGGCAATTCTTGGCAATTCTTTGATGCCGATCTCAAGCCGATCTCAAATTCTGCACTATCATAATTGTATCACTGCTCCTGGTCCATGCACTATCAGCAAACCAGCGGGATCCGCGCCTGCGCTAAAGGATCTGGATAAAGGATCTGGACGCGGGCACCTG

Full Affymetrix probeset data:

Annotations for 1629738_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720