FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629740_at:

>probe:Drosophila_2:1629740_at:189:227; Interrogation_Position=715; Antisense; AAGGCAAAGCCAGCGGTGTCTGCAA
>probe:Drosophila_2:1629740_at:376:169; Interrogation_Position=720; Antisense; AAAGCCAGCGGTGTCTGCAAAACCC
>probe:Drosophila_2:1629740_at:275:313; Interrogation_Position=723; Antisense; GCCAGCGGTGTCTGCAAAACCCAAA
>probe:Drosophila_2:1629740_at:147:329; Interrogation_Position=727; Antisense; GCGGTGTCTGCAAAACCCAAAAAGA
>probe:Drosophila_2:1629740_at:723:553; Interrogation_Position=733; Antisense; TCTGCAAAACCCAAAAAGACGGTGA
>probe:Drosophila_2:1629740_at:130:213; Interrogation_Position=748; Antisense; AAGACGGTGAAGAAAGCATCGGTTT
>probe:Drosophila_2:1629740_at:105:107; Interrogation_Position=758; Antisense; AGAAAGCATCGGTTTCTGCTACCGC
>probe:Drosophila_2:1629740_at:662:41; Interrogation_Position=765; Antisense; ATCGGTTTCTGCTACCGCCAAGAAG
>probe:Drosophila_2:1629740_at:336:715; Interrogation_Position=771; Antisense; TTCTGCTACCGCCAAGAAGCCGAAA
>probe:Drosophila_2:1629740_at:198:393; Interrogation_Position=792; Antisense; GAAAGCGAAGACTACGGCTGCCAAA
>probe:Drosophila_2:1629740_at:573:367; Interrogation_Position=798; Antisense; GAAGACTACGGCTGCCAAAAAGTAA
>probe:Drosophila_2:1629740_at:421:85; Interrogation_Position=833; Antisense; AGTGCAGTATTTGGTACATGTTCGC
>probe:Drosophila_2:1629740_at:281:349; Interrogation_Position=836; Antisense; GCAGTATTTGGTACATGTTCGCAAT
>probe:Drosophila_2:1629740_at:242:535; Interrogation_Position=845; Antisense; GGTACATGTTCGCAATTAAAATTTT

Paste this into a BLAST search page for me
AAGGCAAAGCCAGCGGTGTCTGCAAAAAGCCAGCGGTGTCTGCAAAACCCGCCAGCGGTGTCTGCAAAACCCAAAGCGGTGTCTGCAAAACCCAAAAAGATCTGCAAAACCCAAAAAGACGGTGAAAGACGGTGAAGAAAGCATCGGTTTAGAAAGCATCGGTTTCTGCTACCGCATCGGTTTCTGCTACCGCCAAGAAGTTCTGCTACCGCCAAGAAGCCGAAAGAAAGCGAAGACTACGGCTGCCAAAGAAGACTACGGCTGCCAAAAAGTAAAGTGCAGTATTTGGTACATGTTCGCGCAGTATTTGGTACATGTTCGCAATGGTACATGTTCGCAATTAAAATTTT

Full Affymetrix probeset data:

Annotations for 1629740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720