Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629741_at:

>probe:Drosophila_2:1629741_at:216:267; Interrogation_Position=3837; Antisense; CAGTCGTTTGCTCCTCGTTTTAAGT
>probe:Drosophila_2:1629741_at:383:703; Interrogation_Position=3866; Antisense; TTTTGTATATATTTCCAGCCAGCAG
>probe:Drosophila_2:1629741_at:270:19; Interrogation_Position=3876; Antisense; ATTTCCAGCCAGCAGAATGCAAAAT
>probe:Drosophila_2:1629741_at:341:53; Interrogation_Position=3899; Antisense; ATGCAGCCAGCAGCGAATATAATTA
>probe:Drosophila_2:1629741_at:314:27; Interrogation_Position=3969; Antisense; ATACGAGTTGTATTTATTAGGCGAA
>probe:Drosophila_2:1629741_at:607:197; Interrogation_Position=3993; Antisense; AACGTTTGTGTGGTCGGCGATCGAA
>probe:Drosophila_2:1629741_at:526:325; Interrogation_Position=4009; Antisense; GCGATCGAAGGAGGGTCAGTTAATT
>probe:Drosophila_2:1629741_at:112:683; Interrogation_Position=4055; Antisense; TATCGTAATCGATTACCCTTTTCTT
>probe:Drosophila_2:1629741_at:117:241; Interrogation_Position=4088; Antisense; AATACTTGCGTGTACTTCTCTTAAT
>probe:Drosophila_2:1629741_at:528:239; Interrogation_Position=4132; Antisense; AATACACCTAAACCACTTATTTGTG
>probe:Drosophila_2:1629741_at:681:127; Interrogation_Position=4143; Antisense; ACCACTTATTTGTGTTTACTGTATA
>probe:Drosophila_2:1629741_at:423:169; Interrogation_Position=4183; Antisense; AAAGGCGAGGGCTTTATGCCCATCA
>probe:Drosophila_2:1629741_at:397:525; Interrogation_Position=4191; Antisense; GGGCTTTATGCCCATCAACAGATAA
>probe:Drosophila_2:1629741_at:589:181; Interrogation_Position=4218; Antisense; AAAACTGCGCCAGAGGGAGCGAGAA

Paste this into a BLAST search page for me
CAGTCGTTTGCTCCTCGTTTTAAGTTTTTGTATATATTTCCAGCCAGCAGATTTCCAGCCAGCAGAATGCAAAATATGCAGCCAGCAGCGAATATAATTAATACGAGTTGTATTTATTAGGCGAAAACGTTTGTGTGGTCGGCGATCGAAGCGATCGAAGGAGGGTCAGTTAATTTATCGTAATCGATTACCCTTTTCTTAATACTTGCGTGTACTTCTCTTAATAATACACCTAAACCACTTATTTGTGACCACTTATTTGTGTTTACTGTATAAAAGGCGAGGGCTTTATGCCCATCAGGGCTTTATGCCCATCAACAGATAAAAAACTGCGCCAGAGGGAGCGAGAA

Full Affymetrix probeset data:

Annotations for 1629741_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime