FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629743_at:

>probe:Drosophila_2:1629743_at:128:503; Interrogation_Position=114; Antisense; GTCGCAGCAAAATTCGCATCAGCAG
>probe:Drosophila_2:1629743_at:432:319; Interrogation_Position=180; Antisense; GCCGCAGATGCAAACCCAGATAACA
>probe:Drosophila_2:1629743_at:665:345; Interrogation_Position=208; Antisense; GCACCGGTGGCATCTACCAATTTGA
>probe:Drosophila_2:1629743_at:406:131; Interrogation_Position=360; Antisense; ACCGGCAGTGGTGACAACGACCAGT
>probe:Drosophila_2:1629743_at:98:187; Interrogation_Position=385; Antisense; AACAGTTCGTCGGAGACCCGAAATG
>probe:Drosophila_2:1629743_at:404:399; Interrogation_Position=399; Antisense; GACCCGAAATGCCTCCGAAAATCTG
>probe:Drosophila_2:1629743_at:8:387; Interrogation_Position=415; Antisense; GAAAATCTGGCCACCTCGAGAACCG
>probe:Drosophila_2:1629743_at:282:307; Interrogation_Position=458; Antisense; CCTCTGAGAACAGGCGCGGCATCTT
>probe:Drosophila_2:1629743_at:623:37; Interrogation_Position=478; Antisense; ATCTTACAGCGGCTCTTCGGATGGA
>probe:Drosophila_2:1629743_at:361:65; Interrogation_Position=498; Antisense; ATGGAGCTCGTGATGGGTTCCCCTT
>probe:Drosophila_2:1629743_at:137:265; Interrogation_Position=543; Antisense; CAGCAAACCGTGCACTTTATCGAAG
>probe:Drosophila_2:1629743_at:203:165; Interrogation_Position=57; Antisense; AAATCCCAAATCGAGCGGTGGCAAT
>probe:Drosophila_2:1629743_at:333:705; Interrogation_Position=570; Antisense; TTATCCATTAGATTCTTGAACCGAT
>probe:Drosophila_2:1629743_at:259:81; Interrogation_Position=89; Antisense; AGGGCAAAGGACACCAACACCGGCA

Paste this into a BLAST search page for me
GTCGCAGCAAAATTCGCATCAGCAGGCCGCAGATGCAAACCCAGATAACAGCACCGGTGGCATCTACCAATTTGAACCGGCAGTGGTGACAACGACCAGTAACAGTTCGTCGGAGACCCGAAATGGACCCGAAATGCCTCCGAAAATCTGGAAAATCTGGCCACCTCGAGAACCGCCTCTGAGAACAGGCGCGGCATCTTATCTTACAGCGGCTCTTCGGATGGAATGGAGCTCGTGATGGGTTCCCCTTCAGCAAACCGTGCACTTTATCGAAGAAATCCCAAATCGAGCGGTGGCAATTTATCCATTAGATTCTTGAACCGATAGGGCAAAGGACACCAACACCGGCA

Full Affymetrix probeset data:

Annotations for 1629743_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720