FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629745_at:

>probe:Drosophila_2:1629745_at:61:131; Interrogation_Position=1346; Antisense; ACCTACGGCGAGATCATCCAGAATG
>probe:Drosophila_2:1629745_at:251:369; Interrogation_Position=1366; Antisense; GAATGCCATCAACAAGGTGCTGAAC
>probe:Drosophila_2:1629745_at:128:305; Interrogation_Position=1402; Antisense; GCGTACTAAGGATCTGGGCGGACAA
>probe:Drosophila_2:1629745_at:2:559; Interrogation_Position=1421; Antisense; GGACAATCGACCACGCAGGACTTTA
>probe:Drosophila_2:1629745_at:174:315; Interrogation_Position=1451; Antisense; GCCATCATCCTGAACATGTCCTAGA
>probe:Drosophila_2:1629745_at:477:189; Interrogation_Position=1463; Antisense; AACATGTCCTAGATGGGCACCACTG
>probe:Drosophila_2:1629745_at:357:347; Interrogation_Position=1497; Antisense; GCATCGCGATCAGCAAGTCTACAAC
>probe:Drosophila_2:1629745_at:621:565; Interrogation_Position=1528; Antisense; GGCAACAACGTTGGCGCTTATATAA
>probe:Drosophila_2:1629745_at:351:7; Interrogation_Position=1558; Antisense; ATTAGACAGTTTCTGTTGTTGCCAC
>probe:Drosophila_2:1629745_at:149:473; Interrogation_Position=1620; Antisense; GTTCTTAGTTATCCTATTACGTCCA
>probe:Drosophila_2:1629745_at:292:689; Interrogation_Position=1653; Antisense; TATTTGTCCCGATGTCTTCAGTGCA
>probe:Drosophila_2:1629745_at:547:645; Interrogation_Position=1679; Antisense; TCATTTGAGTATTATTTCCGGCGAA
>probe:Drosophila_2:1629745_at:358:699; Interrogation_Position=1712; Antisense; TTTAGTCCAATTGAAACGCCTGCAG
>probe:Drosophila_2:1629745_at:427:569; Interrogation_Position=1783; Antisense; GGCAGTAATACATCGATCCTTGATT

Paste this into a BLAST search page for me
ACCTACGGCGAGATCATCCAGAATGGAATGCCATCAACAAGGTGCTGAACGCGTACTAAGGATCTGGGCGGACAAGGACAATCGACCACGCAGGACTTTAGCCATCATCCTGAACATGTCCTAGAAACATGTCCTAGATGGGCACCACTGGCATCGCGATCAGCAAGTCTACAACGGCAACAACGTTGGCGCTTATATAAATTAGACAGTTTCTGTTGTTGCCACGTTCTTAGTTATCCTATTACGTCCATATTTGTCCCGATGTCTTCAGTGCATCATTTGAGTATTATTTCCGGCGAATTTAGTCCAATTGAAACGCCTGCAGGGCAGTAATACATCGATCCTTGATT

Full Affymetrix probeset data:

Annotations for 1629745_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720