Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629746_at:

>probe:Drosophila_2:1629746_at:498:413; Interrogation_Position=2074; Antisense; GACCTGCCCGATATCGTGATGGATG
>probe:Drosophila_2:1629746_at:554:441; Interrogation_Position=2121; Antisense; GATGTACGAAGCCACACCGAAGAGT
>probe:Drosophila_2:1629746_at:513:213; Interrogation_Position=2140; Antisense; AAGAGTATTACTCATCGCCAGCACG
>probe:Drosophila_2:1629746_at:266:583; Interrogation_Position=2204; Antisense; TGGCGGATGTCGAGCTGAAGCACCT
>probe:Drosophila_2:1629746_at:297:245; Interrogation_Position=2270; Antisense; AATTCCTGTTGGACAATTCGCCAGC
>probe:Drosophila_2:1629746_at:447:321; Interrogation_Position=2302; Antisense; GCCCTCATCGATTTGCGCAGTGTAG
>probe:Drosophila_2:1629746_at:654:599; Interrogation_Position=2322; Antisense; TGTAGTCGAGTTCGGACGCGTCCAT
>probe:Drosophila_2:1629746_at:707:625; Interrogation_Position=2348; Antisense; TGCCGCATAGCATCAACATACCGTT
>probe:Drosophila_2:1629746_at:439:187; Interrogation_Position=2393; Antisense; AACAGCGATTGGAGGCCCTGCAGGT
>probe:Drosophila_2:1629746_at:710:617; Interrogation_Position=2411; Antisense; TGCAGGTGCCCCAATTGGAGGCGCA
>probe:Drosophila_2:1629746_at:262:251; Interrogation_Position=2445; Antisense; CAAGATCGTCGTCTGCGTGAGCAAT
>probe:Drosophila_2:1629746_at:726:241; Interrogation_Position=2467; Antisense; AATATCCATCAGCACTCCGTGGAGG
>probe:Drosophila_2:1629746_at:724:47; Interrogation_Position=2498; Antisense; ATCCACTGGCGCAATTGAAGCTTCT
>probe:Drosophila_2:1629746_at:570:663; Interrogation_Position=2531; Antisense; TAAAGTCATTCCCTATTTCGCAGTT

Paste this into a BLAST search page for me
GACCTGCCCGATATCGTGATGGATGGATGTACGAAGCCACACCGAAGAGTAAGAGTATTACTCATCGCCAGCACGTGGCGGATGTCGAGCTGAAGCACCTAATTCCTGTTGGACAATTCGCCAGCGCCCTCATCGATTTGCGCAGTGTAGTGTAGTCGAGTTCGGACGCGTCCATTGCCGCATAGCATCAACATACCGTTAACAGCGATTGGAGGCCCTGCAGGTTGCAGGTGCCCCAATTGGAGGCGCACAAGATCGTCGTCTGCGTGAGCAATAATATCCATCAGCACTCCGTGGAGGATCCACTGGCGCAATTGAAGCTTCTTAAAGTCATTCCCTATTTCGCAGTT

Full Affymetrix probeset data:

Annotations for 1629746_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime