FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629747_at:

>probe:Drosophila_2:1629747_at:288:119; Interrogation_Position=148; Antisense; AGCTGCCACCATTGTCAAGCAGGAT
>probe:Drosophila_2:1629747_at:594:611; Interrogation_Position=177; Antisense; TGAACAACGCCGACGGTAGCTTCAA
>probe:Drosophila_2:1629747_at:491:671; Interrogation_Position=228; Antisense; TACGCGTAGAGAACATTGGCTATCT
>probe:Drosophila_2:1629747_at:50:375; Interrogation_Position=256; Antisense; GAAGATCATCGTTCCCAAGACCGAG
>probe:Drosophila_2:1629747_at:277:213; Interrogation_Position=272; Antisense; AAGACCGAGACCTCCGATGGCCAGG
>probe:Drosophila_2:1629747_at:255:295; Interrogation_Position=310; Antisense; CGAGGAGCTTGTACTGGTCCAGACC
>probe:Drosophila_2:1629747_at:669:103; Interrogation_Position=330; Antisense; AGACCGGATCCTACAGCTACAGCGA
>probe:Drosophila_2:1629747_at:615:665; Interrogation_Position=347; Antisense; TACAGCGATCCCGATGGCAATCTCA
>probe:Drosophila_2:1629747_at:242:601; Interrogation_Position=42; Antisense; TGTACAAGTTAGTCTTCCTCGTCTG
>probe:Drosophila_2:1629747_at:280:317; Interrogation_Position=427; Antisense; GCCGGTGGCACCTCAATAGTTTAAC
>probe:Drosophila_2:1629747_at:140:597; Interrogation_Position=475; Antisense; TGTCCATAGATGTCCCCTGTAATAT
>probe:Drosophila_2:1629747_at:115:61; Interrogation_Position=484; Antisense; ATGTCCCCTGTAATATTTCGCTTGA
>probe:Drosophila_2:1629747_at:638:703; Interrogation_Position=514; Antisense; TTATGCACTGCCTGAATGCCATACG
>probe:Drosophila_2:1629747_at:21:667; Interrogation_Position=552; Antisense; TACATTCCGTAGTTAGTCTTAAGCA

Paste this into a BLAST search page for me
AGCTGCCACCATTGTCAAGCAGGATTGAACAACGCCGACGGTAGCTTCAATACGCGTAGAGAACATTGGCTATCTGAAGATCATCGTTCCCAAGACCGAGAAGACCGAGACCTCCGATGGCCAGGCGAGGAGCTTGTACTGGTCCAGACCAGACCGGATCCTACAGCTACAGCGATACAGCGATCCCGATGGCAATCTCATGTACAAGTTAGTCTTCCTCGTCTGGCCGGTGGCACCTCAATAGTTTAACTGTCCATAGATGTCCCCTGTAATATATGTCCCCTGTAATATTTCGCTTGATTATGCACTGCCTGAATGCCATACGTACATTCCGTAGTTAGTCTTAAGCA

Full Affymetrix probeset data:

Annotations for 1629747_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720