Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629749_a_at:

>probe:Drosophila_2:1629749_a_at:177:97; Interrogation_Position=1228; Antisense; AGATCGCCTTCAATAGTGGCCAGGA
>probe:Drosophila_2:1629749_a_at:674:425; Interrogation_Position=1329; Antisense; GAGAGGCGACTGATGGACTATCCCA
>probe:Drosophila_2:1629749_a_at:6:403; Interrogation_Position=1344; Antisense; GACTATCCCATTGAGCTGCCGGAGG
>probe:Drosophila_2:1629749_a_at:59:549; Interrogation_Position=1364; Antisense; GGAGGTGATTCCCAGTCGACTGACC
>probe:Drosophila_2:1629749_a_at:278:101; Interrogation_Position=1405; Antisense; AGAGGGTCACCTACATGCCCAAGTT
>probe:Drosophila_2:1629749_a_at:615:469; Interrogation_Position=1427; Antisense; GTTGCGCAAGCGTCTGTTCAAGTTC
>probe:Drosophila_2:1629749_a_at:507:399; Interrogation_Position=1485; Antisense; GACAGCGATATACGTCCGGACATTG
>probe:Drosophila_2:1629749_a_at:464:401; Interrogation_Position=1503; Antisense; GACATTGTTTTCGATCCGGAGCACC
>probe:Drosophila_2:1629749_a_at:522:97; Interrogation_Position=1549; Antisense; AGATCGATGAGACCGCGTTCTACAA
>probe:Drosophila_2:1629749_a_at:630:431; Interrogation_Position=1605; Antisense; GAGGGTTCAGATGCTACCGGTTTGA
>probe:Drosophila_2:1629749_a_at:606:389; Interrogation_Position=1687; Antisense; GAAACAATGGTAGCGCTGCGGATCC
>probe:Drosophila_2:1629749_a_at:17:449; Interrogation_Position=1707; Antisense; GATCCGTTGGAACCCAAGAGCGCTT
>probe:Drosophila_2:1629749_a_at:565:213; Interrogation_Position=1722; Antisense; AAGAGCGCTTCCCAGATATCATTCC
>probe:Drosophila_2:1629749_a_at:245:241; Interrogation_Position=1750; Antisense; AATAAAATGGCCAGCGGCTCTGCTC

Paste this into a BLAST search page for me
AGATCGCCTTCAATAGTGGCCAGGAGAGAGGCGACTGATGGACTATCCCAGACTATCCCATTGAGCTGCCGGAGGGGAGGTGATTCCCAGTCGACTGACCAGAGGGTCACCTACATGCCCAAGTTGTTGCGCAAGCGTCTGTTCAAGTTCGACAGCGATATACGTCCGGACATTGGACATTGTTTTCGATCCGGAGCACCAGATCGATGAGACCGCGTTCTACAAGAGGGTTCAGATGCTACCGGTTTGAGAAACAATGGTAGCGCTGCGGATCCGATCCGTTGGAACCCAAGAGCGCTTAAGAGCGCTTCCCAGATATCATTCCAATAAAATGGCCAGCGGCTCTGCTC

Full Affymetrix probeset data:

Annotations for 1629749_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime