FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629750_at:

>probe:Drosophila_2:1629750_at:269:447; Interrogation_Position=1004; Antisense; GATGCCAACCAAATGCCGACTAACG
>probe:Drosophila_2:1629750_at:361:621; Interrogation_Position=593; Antisense; TGCTGCCACGGAGGACTGAGTCCAT
>probe:Drosophila_2:1629750_at:558:307; Interrogation_Position=614; Antisense; CCATCGCTCCGGAATTTGCAACAGA
>probe:Drosophila_2:1629750_at:211:97; Interrogation_Position=636; Antisense; AGATCAATCATATTCAGCGACCCAC
>probe:Drosophila_2:1629750_at:611:325; Interrogation_Position=652; Antisense; GCGACCCACTGATATTCCGGATGAG
>probe:Drosophila_2:1629750_at:356:435; Interrogation_Position=674; Antisense; GAGGGTATCATGTGCGATCTCCTTT
>probe:Drosophila_2:1629750_at:191:525; Interrogation_Position=699; Antisense; GGGCGGATCTAAATCACACCACCAA
>probe:Drosophila_2:1629750_at:709:173; Interrogation_Position=791; Antisense; AAAGCCTTCGACTTGCAACTTATGG
>probe:Drosophila_2:1629750_at:163:255; Interrogation_Position=806; Antisense; CAACTTATGGTTCGCGCCCATGAGG
>probe:Drosophila_2:1629750_at:236:429; Interrogation_Position=848; Antisense; GAGTTCTTTGCCAACCGACAGCTGG
>probe:Drosophila_2:1629750_at:660:483; Interrogation_Position=903; Antisense; GTATGATGAACAATGCCGGCGGAGT
>probe:Drosophila_2:1629750_at:688:475; Interrogation_Position=935; Antisense; GTTAGCACAGACTTGATCTGCTCCT
>probe:Drosophila_2:1629750_at:127:639; Interrogation_Position=960; Antisense; TCGTCATTATTCTACCGTGTCACAA
>probe:Drosophila_2:1629750_at:381:231; Interrogation_Position=991; Antisense; AATGATTGCGACTGATGCCAACCAA

Paste this into a BLAST search page for me
GATGCCAACCAAATGCCGACTAACGTGCTGCCACGGAGGACTGAGTCCATCCATCGCTCCGGAATTTGCAACAGAAGATCAATCATATTCAGCGACCCACGCGACCCACTGATATTCCGGATGAGGAGGGTATCATGTGCGATCTCCTTTGGGCGGATCTAAATCACACCACCAAAAAGCCTTCGACTTGCAACTTATGGCAACTTATGGTTCGCGCCCATGAGGGAGTTCTTTGCCAACCGACAGCTGGGTATGATGAACAATGCCGGCGGAGTGTTAGCACAGACTTGATCTGCTCCTTCGTCATTATTCTACCGTGTCACAAAATGATTGCGACTGATGCCAACCAA

Full Affymetrix probeset data:

Annotations for 1629750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720