FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629751_at:

>probe:Drosophila_2:1629751_at:266:561; Interrogation_Position=1055; Antisense; GGAAAAACTTCCTTGGCCATGACTG
>probe:Drosophila_2:1629751_at:139:395; Interrogation_Position=1112; Antisense; GAAATGCGTACCGTTCTGAATAGAA
>probe:Drosophila_2:1629751_at:628:373; Interrogation_Position=1142; Antisense; GAAGTCACGCGAGCCATTCAGAAAC
>probe:Drosophila_2:1629751_at:351:173; Interrogation_Position=1205; Antisense; AAAGACTACGTGACTCTGGATGAGC
>probe:Drosophila_2:1629751_at:665:425; Interrogation_Position=1231; Antisense; GAGAGCACAGCTCCAGGACTATGAG
>probe:Drosophila_2:1629751_at:153:373; Interrogation_Position=1289; Antisense; GAAGAGGCCCACGTCCTTGAAAAGG
>probe:Drosophila_2:1629751_at:53:379; Interrogation_Position=1354; Antisense; GAAGCTCAACAATGCCATACGTCGG
>probe:Drosophila_2:1629751_at:90:271; Interrogation_Position=1369; Antisense; CATACGTCGGCGAAATCGGCTCGAA
>probe:Drosophila_2:1629751_at:393:287; Interrogation_Position=809; Antisense; CGGAAATTGCGCAAGTTCACTTCAA
>probe:Drosophila_2:1629751_at:178:233; Interrogation_Position=845; Antisense; AATGCACGCGCTTTACTGGGAACTA
>probe:Drosophila_2:1629751_at:623:473; Interrogation_Position=874; Antisense; GTTAACCATAGTATCGCTTCAAGAA
>probe:Drosophila_2:1629751_at:291:107; Interrogation_Position=895; Antisense; AGAAACATGTCAGCAGCATCGGGCG
>probe:Drosophila_2:1629751_at:646:261; Interrogation_Position=908; Antisense; CAGCATCGGGCGGATTTGATAACCA
>probe:Drosophila_2:1629751_at:72:131; Interrogation_Position=939; Antisense; ACCTGAGTGGTATCCTGACGGCTGT

Paste this into a BLAST search page for me
GGAAAAACTTCCTTGGCCATGACTGGAAATGCGTACCGTTCTGAATAGAAGAAGTCACGCGAGCCATTCAGAAACAAAGACTACGTGACTCTGGATGAGCGAGAGCACAGCTCCAGGACTATGAGGAAGAGGCCCACGTCCTTGAAAAGGGAAGCTCAACAATGCCATACGTCGGCATACGTCGGCGAAATCGGCTCGAACGGAAATTGCGCAAGTTCACTTCAAAATGCACGCGCTTTACTGGGAACTAGTTAACCATAGTATCGCTTCAAGAAAGAAACATGTCAGCAGCATCGGGCGCAGCATCGGGCGGATTTGATAACCAACCTGAGTGGTATCCTGACGGCTGT

Full Affymetrix probeset data:

Annotations for 1629751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720