Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629752_at:

>probe:Drosophila_2:1629752_at:572:295; Interrogation_Position=1390; Antisense; CGAGATTGAGATGGCCCTGCAGCTA
>probe:Drosophila_2:1629752_at:506:689; Interrogation_Position=1451; Antisense; TATTGCTTCCGTGCATTTGCCGATG
>probe:Drosophila_2:1629752_at:17:695; Interrogation_Position=1466; Antisense; TTTGCCGATGCTTTGGAGGTGATTC
>probe:Drosophila_2:1629752_at:97:423; Interrogation_Position=1505; Antisense; GAGAACGCCGGTTTGAATCCCATTG
>probe:Drosophila_2:1629752_at:705:221; Interrogation_Position=1595; Antisense; AAGGGCGCCATCACAGACATTTTCG
>probe:Drosophila_2:1629752_at:162:701; Interrogation_Position=1614; Antisense; TTTTCGCGGAGAACGTTGTGCAGCC
>probe:Drosophila_2:1629752_at:535:283; Interrogation_Position=1640; Antisense; CTGCTGGTCAGTATTTCGTCGATCA
>probe:Drosophila_2:1629752_at:173:287; Interrogation_Position=1667; Antisense; CTGGCCACGGAGACGATTCGATCGA
>probe:Drosophila_2:1629752_at:117:409; Interrogation_Position=1703; Antisense; GACGATATTGTCAACACCTTCAGTT
>probe:Drosophila_2:1629752_at:529:657; Interrogation_Position=1727; Antisense; TAAGCAGTGTAATCCGCATTCTTCG
>probe:Drosophila_2:1629752_at:687:275; Interrogation_Position=1808; Antisense; CTTATGTCCATTATGCGGTTGCGCA
>probe:Drosophila_2:1629752_at:184:163; Interrogation_Position=1847; Antisense; AAATTCACATATACACTACGCCTCA
>probe:Drosophila_2:1629752_at:726:133; Interrogation_Position=1864; Antisense; ACGCCTCACCAGCTTAACATGTATT
>probe:Drosophila_2:1629752_at:644:231; Interrogation_Position=1912; Antisense; AATACTTCGCTAACACAACCTACAT

Paste this into a BLAST search page for me
CGAGATTGAGATGGCCCTGCAGCTATATTGCTTCCGTGCATTTGCCGATGTTTGCCGATGCTTTGGAGGTGATTCGAGAACGCCGGTTTGAATCCCATTGAAGGGCGCCATCACAGACATTTTCGTTTTCGCGGAGAACGTTGTGCAGCCCTGCTGGTCAGTATTTCGTCGATCACTGGCCACGGAGACGATTCGATCGAGACGATATTGTCAACACCTTCAGTTTAAGCAGTGTAATCCGCATTCTTCGCTTATGTCCATTATGCGGTTGCGCAAAATTCACATATACACTACGCCTCAACGCCTCACCAGCTTAACATGTATTAATACTTCGCTAACACAACCTACAT

Full Affymetrix probeset data:

Annotations for 1629752_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime