Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629753_at:

>probe:Drosophila_2:1629753_at:729:599; Interrogation_Position=2040; Antisense; TGTACAAAGTAAGCCATACCGTATG
>probe:Drosophila_2:1629753_at:616:27; Interrogation_Position=2055; Antisense; ATACCGTATGCTTGTTACCGCCAAA
>probe:Drosophila_2:1629753_at:164:165; Interrogation_Position=2092; Antisense; AAATCGAAAATGTCGTGCCATTCTT
>probe:Drosophila_2:1629753_at:39:501; Interrogation_Position=2103; Antisense; GTCGTGCCATTCTTTACCTTAAATT
>probe:Drosophila_2:1629753_at:365:475; Interrogation_Position=2131; Antisense; GTTATATTCTTAGGTTCGGAATCTT
>probe:Drosophila_2:1629753_at:462:539; Interrogation_Position=2143; Antisense; GGTTCGGAATCTTAAATTGTACATA
>probe:Drosophila_2:1629753_at:570:725; Interrogation_Position=2159; Antisense; TTGTACATATTCAGCTTACACAGCT
>probe:Drosophila_2:1629753_at:618:263; Interrogation_Position=2170; Antisense; CAGCTTACACAGCTGCCAATTGTAA
>probe:Drosophila_2:1629753_at:303:247; Interrogation_Position=2186; Antisense; CAATTGTAAAGTAATCGGCGCTCTA
>probe:Drosophila_2:1629753_at:552:237; Interrogation_Position=2198; Antisense; AATCGGCGCTCTAAACATGCATTGT
>probe:Drosophila_2:1629753_at:102:249; Interrogation_Position=2327; Antisense; CAATGCCAATAATCTTCAAATCAAA
>probe:Drosophila_2:1629753_at:468:455; Interrogation_Position=2388; Antisense; GATAATTGTTCTGTTTGCATTCTCT
>probe:Drosophila_2:1629753_at:153:473; Interrogation_Position=2395; Antisense; GTTCTGTTTGCATTCTCTATTTAAA
>probe:Drosophila_2:1629753_at:153:247; Interrogation_Position=2517; Antisense; AATTGTTGCTGCTTCAAATATAAAC

Paste this into a BLAST search page for me
TGTACAAAGTAAGCCATACCGTATGATACCGTATGCTTGTTACCGCCAAAAAATCGAAAATGTCGTGCCATTCTTGTCGTGCCATTCTTTACCTTAAATTGTTATATTCTTAGGTTCGGAATCTTGGTTCGGAATCTTAAATTGTACATATTGTACATATTCAGCTTACACAGCTCAGCTTACACAGCTGCCAATTGTAACAATTGTAAAGTAATCGGCGCTCTAAATCGGCGCTCTAAACATGCATTGTCAATGCCAATAATCTTCAAATCAAAGATAATTGTTCTGTTTGCATTCTCTGTTCTGTTTGCATTCTCTATTTAAAAATTGTTGCTGCTTCAAATATAAAC

Full Affymetrix probeset data:

Annotations for 1629753_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime