FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629756_at:

>probe:Drosophila_2:1629756_at:376:725; Interrogation_Position=2232; Antisense; TTGACCACTATCACGAAGGCGCATT
>probe:Drosophila_2:1629756_at:646:69; Interrogation_Position=2248; Antisense; AGGCGCATTGCGTTCGGCATTAGAA
>probe:Drosophila_2:1629756_at:53:395; Interrogation_Position=2270; Antisense; GAAATCCTGACCAACAATCATCTGA
>probe:Drosophila_2:1629756_at:36:27; Interrogation_Position=2294; Antisense; ATACCCGCCAGCTCATTGGAAGTGG
>probe:Drosophila_2:1629756_at:393:173; Interrogation_Position=2338; Antisense; AAAGCGGATGGGTCCCGAGGTCATT
>probe:Drosophila_2:1629756_at:632:435; Interrogation_Position=2354; Antisense; GAGGTCATTAAAGTGCTGCCCGATA
>probe:Drosophila_2:1629756_at:92:683; Interrogation_Position=2377; Antisense; TATCCTGCTGGCGTCCATGGACATT
>probe:Drosophila_2:1629756_at:135:189; Interrogation_Position=2440; Antisense; AACAGCTTCCGGTTTCTTTGATGAA
>probe:Drosophila_2:1629756_at:540:223; Interrogation_Position=2480; Antisense; AAGGAGCCCGCCGTGAAACATTTGC
>probe:Drosophila_2:1629756_at:600:187; Interrogation_Position=2496; Antisense; AACATTTGCGAGACAGGGCCAAGGC
>probe:Drosophila_2:1629756_at:233:83; Interrogation_Position=2510; Antisense; AGGGCCAAGGCATTCACCAACATGG
>probe:Drosophila_2:1629756_at:220:333; Interrogation_Position=2587; Antisense; GCTGGAGATCCTTATGCACTAACAT
>probe:Drosophila_2:1629756_at:164:681; Interrogation_Position=2641; Antisense; TATGCATTTCATTCAGTTCGTTTAA
>probe:Drosophila_2:1629756_at:252:363; Interrogation_Position=2711; Antisense; GAATTTTTCTGTTAAGCGCAACGCA

Paste this into a BLAST search page for me
TTGACCACTATCACGAAGGCGCATTAGGCGCATTGCGTTCGGCATTAGAAGAAATCCTGACCAACAATCATCTGAATACCCGCCAGCTCATTGGAAGTGGAAAGCGGATGGGTCCCGAGGTCATTGAGGTCATTAAAGTGCTGCCCGATATATCCTGCTGGCGTCCATGGACATTAACAGCTTCCGGTTTCTTTGATGAAAAGGAGCCCGCCGTGAAACATTTGCAACATTTGCGAGACAGGGCCAAGGCAGGGCCAAGGCATTCACCAACATGGGCTGGAGATCCTTATGCACTAACATTATGCATTTCATTCAGTTCGTTTAAGAATTTTTCTGTTAAGCGCAACGCA

Full Affymetrix probeset data:

Annotations for 1629756_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720