FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629758_at:

>probe:Drosophila_2:1629758_at:556:33; Interrogation_Position=1005; Antisense; ATCACTAGGGTTATTGCTGCCGCTC
>probe:Drosophila_2:1629758_at:377:307; Interrogation_Position=1073; Antisense; CCTAGCACCCTACGATGTGTGTTTA
>probe:Drosophila_2:1629758_at:146:219; Interrogation_Position=1164; Antisense; AATGTAGGAGAGATTTGCGGCCACC
>probe:Drosophila_2:1629758_at:689:287; Interrogation_Position=1181; Antisense; CGGCCACCAGGAGTTGTTGCATGAT
>probe:Drosophila_2:1629758_at:642:223; Interrogation_Position=1212; Antisense; AAGGAGCTGACTATCGGCAAACGTT
>probe:Drosophila_2:1629758_at:535:693; Interrogation_Position=1235; Antisense; TTTGCTGGAAGCCAAGCGTCTCGGA
>probe:Drosophila_2:1629758_at:236:641; Interrogation_Position=1255; Antisense; TCGGACATCCGCTTACGATTGTAGT
>probe:Drosophila_2:1629758_at:682:525; Interrogation_Position=1280; Antisense; GGGAGCCAAGTCAGCCCGTCTGGAT
>probe:Drosophila_2:1629758_at:687:415; Interrogation_Position=1347; Antisense; GAGCTCGATTTCAGTGAAACCCTGA
>probe:Drosophila_2:1629758_at:456:169; Interrogation_Position=1447; Antisense; AAAGTCGATCGGTTGGCCATCAGCT
>probe:Drosophila_2:1629758_at:380:715; Interrogation_Position=880; Antisense; TTCGAGGAGTTGAGGTGGCCCACAC
>probe:Drosophila_2:1629758_at:560:395; Interrogation_Position=918; Antisense; GACAAGTACTCCAAACCCTTGGGCG
>probe:Drosophila_2:1629758_at:574:361; Interrogation_Position=971; Antisense; GCAATCGCTGGTCATGGGCTGTTAT
>probe:Drosophila_2:1629758_at:251:523; Interrogation_Position=986; Antisense; GGGCTGTTATGGTATTGGCATCACT

Paste this into a BLAST search page for me
ATCACTAGGGTTATTGCTGCCGCTCCCTAGCACCCTACGATGTGTGTTTAAATGTAGGAGAGATTTGCGGCCACCCGGCCACCAGGAGTTGTTGCATGATAAGGAGCTGACTATCGGCAAACGTTTTTGCTGGAAGCCAAGCGTCTCGGATCGGACATCCGCTTACGATTGTAGTGGGAGCCAAGTCAGCCCGTCTGGATGAGCTCGATTTCAGTGAAACCCTGAAAAGTCGATCGGTTGGCCATCAGCTTTCGAGGAGTTGAGGTGGCCCACACGACAAGTACTCCAAACCCTTGGGCGGCAATCGCTGGTCATGGGCTGTTATGGGCTGTTATGGTATTGGCATCACT

Full Affymetrix probeset data:

Annotations for 1629758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720