FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629759_at:

>probe:Drosophila_2:1629759_at:187:19; Interrogation_Position=1074; Antisense; ATTTGCGAGGGAAATTCTCCAGCGC
>probe:Drosophila_2:1629759_at:637:309; Interrogation_Position=1092; Antisense; CCAGCGCGAGACGTTTCAGAGTATA
>probe:Drosophila_2:1629759_at:547:403; Interrogation_Position=1126; Antisense; GACTTTGATATTTCTTCGCTGCTAA
>probe:Drosophila_2:1629759_at:634:261; Interrogation_Position=643; Antisense; CAGCGATGATGTGCCGATTTTCCAG
>probe:Drosophila_2:1629759_at:473:15; Interrogation_Position=659; Antisense; ATTTTCCAGGCGCATGGCGACTACG
>probe:Drosophila_2:1629759_at:236:135; Interrogation_Position=681; Antisense; ACGATCCCGTGGTGCCGTACAAATT
>probe:Drosophila_2:1629759_at:487:665; Interrogation_Position=698; Antisense; TACAAATTCGGCCAGCTGAGCGCCA
>probe:Drosophila_2:1629759_at:148:263; Interrogation_Position=721; Antisense; CAGCCTGCTCAAGTCGTTCATGAAG
>probe:Drosophila_2:1629759_at:692:665; Interrogation_Position=764; Antisense; TACAGTGGACTATCGCACTCGTCGT
>probe:Drosophila_2:1629759_at:236:409; Interrogation_Position=806; Antisense; GACGTCAAGGACATCATCAGTAAAT
>probe:Drosophila_2:1629759_at:310:719; Interrogation_Position=843; Antisense; TTCCACTGAACCATAGCACTCTTAG
>probe:Drosophila_2:1629759_at:446:469; Interrogation_Position=895; Antisense; GTTGCATTCCAACTATTCACGCAAT
>probe:Drosophila_2:1629759_at:565:277; Interrogation_Position=907; Antisense; CTATTCACGCAATATGGAGCGCAGT
>probe:Drosophila_2:1629759_at:120:91; Interrogation_Position=958; Antisense; AGTAGGCTCTCTCGTAGCCCAATTA

Paste this into a BLAST search page for me
ATTTGCGAGGGAAATTCTCCAGCGCCCAGCGCGAGACGTTTCAGAGTATAGACTTTGATATTTCTTCGCTGCTAACAGCGATGATGTGCCGATTTTCCAGATTTTCCAGGCGCATGGCGACTACGACGATCCCGTGGTGCCGTACAAATTTACAAATTCGGCCAGCTGAGCGCCACAGCCTGCTCAAGTCGTTCATGAAGTACAGTGGACTATCGCACTCGTCGTGACGTCAAGGACATCATCAGTAAATTTCCACTGAACCATAGCACTCTTAGGTTGCATTCCAACTATTCACGCAATCTATTCACGCAATATGGAGCGCAGTAGTAGGCTCTCTCGTAGCCCAATTA

Full Affymetrix probeset data:

Annotations for 1629759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720