Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629761_at:

>probe:Drosophila_2:1629761_at:474:379; Interrogation_Position=1012; Antisense; GAACGCCTGTACAAGTCGCGACGAC
>probe:Drosophila_2:1629761_at:372:403; Interrogation_Position=1034; Antisense; GACTAAATGGTACCTCCTGTGTGCT
>probe:Drosophila_2:1629761_at:227:73; Interrogation_Position=1084; Antisense; AGGCAACAGCATGTCCTTCGAGGGA
>probe:Drosophila_2:1629761_at:191:51; Interrogation_Position=1112; Antisense; ATGCGGTCAGGCCACAAAGCTTTAT
>probe:Drosophila_2:1629761_at:578:239; Interrogation_Position=1143; Antisense; AATACTCTCGGCCATCTTTCAATTG
>probe:Drosophila_2:1629761_at:471:247; Interrogation_Position=1163; Antisense; AATTGCCCAGCAGCGATGACGTGGA
>probe:Drosophila_2:1629761_at:248:133; Interrogation_Position=1199; Antisense; AACTTGAGCTAATGATTTCCCCTAA
>probe:Drosophila_2:1629761_at:397:279; Interrogation_Position=1220; Antisense; CTAATTATCTGGAGGCACATCGGCA
>probe:Drosophila_2:1629761_at:2:361; Interrogation_Position=1250; Antisense; GCAACTGTCGGCAAATCTACGGTGA
>probe:Drosophila_2:1629761_at:299:139; Interrogation_Position=1274; Antisense; ACTGTAATCACACGTTCTGGTTGGA
>probe:Drosophila_2:1629761_at:144:139; Interrogation_Position=748; Antisense; ACGGGCGCTGACAACTGGTGGACAC
>probe:Drosophila_2:1629761_at:9:327; Interrogation_Position=855; Antisense; GCGACCCCGAGAAGTGCTACGAGCA
>probe:Drosophila_2:1629761_at:213:191; Interrogation_Position=887; Antisense; AACATCACATATATCCCGTTTTCGC
>probe:Drosophila_2:1629761_at:145:351; Interrogation_Position=929; Antisense; GCAGTCTTGATCAGGATGCCCACTT

Paste this into a BLAST search page for me
GAACGCCTGTACAAGTCGCGACGACGACTAAATGGTACCTCCTGTGTGCTAGGCAACAGCATGTCCTTCGAGGGAATGCGGTCAGGCCACAAAGCTTTATAATACTCTCGGCCATCTTTCAATTGAATTGCCCAGCAGCGATGACGTGGAAACTTGAGCTAATGATTTCCCCTAACTAATTATCTGGAGGCACATCGGCAGCAACTGTCGGCAAATCTACGGTGAACTGTAATCACACGTTCTGGTTGGAACGGGCGCTGACAACTGGTGGACACGCGACCCCGAGAAGTGCTACGAGCAAACATCACATATATCCCGTTTTCGCGCAGTCTTGATCAGGATGCCCACTT

Full Affymetrix probeset data:

Annotations for 1629761_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime