FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629762_at:

>probe:Drosophila_2:1629762_at:47:563; Interrogation_Position=3019; Antisense; GGAACGGTGTACAGCATACTCGAGA
>probe:Drosophila_2:1629762_at:604:25; Interrogation_Position=3034; Antisense; ATACTCGAGAATAATTCCGGTGACA
>probe:Drosophila_2:1629762_at:117:539; Interrogation_Position=3075; Antisense; GGTTTCATATTTCAGACCTATTTTT
>probe:Drosophila_2:1629762_at:679:5; Interrogation_Position=3106; Antisense; TATTAGGTTCATGTTTTGGTTGTAC
>probe:Drosophila_2:1629762_at:467:473; Interrogation_Position=3118; Antisense; GTTTTGGTTGTACATGACGGATTTC
>probe:Drosophila_2:1629762_at:515:605; Interrogation_Position=3132; Antisense; TGACGGATTTCTTGGTGGTGTTAAA
>probe:Drosophila_2:1629762_at:355:533; Interrogation_Position=3148; Antisense; GGTGTTAAACACGTCCTTGCAAAAG
>probe:Drosophila_2:1629762_at:668:477; Interrogation_Position=3322; Antisense; GTTTAAGAGATTTATTCGCATTGCA
>probe:Drosophila_2:1629762_at:496:245; Interrogation_Position=3352; Antisense; AATTCTTGTGTGTCGAAGTTGTGCT
>probe:Drosophila_2:1629762_at:54:215; Interrogation_Position=3367; Antisense; AAGTTGTGCTTTAGTTCGTTTCCAT
>probe:Drosophila_2:1629762_at:646:471; Interrogation_Position=3380; Antisense; GTTCGTTTCCATGAAGTCTATCAAA
>probe:Drosophila_2:1629762_at:352:213; Interrogation_Position=3471; Antisense; AAGAGTGAAAATGGCGCGTCGAAAA
>probe:Drosophila_2:1629762_at:472:179; Interrogation_Position=3494; Antisense; AAACAGAAGCTTCTTCCTTCCATGT
>probe:Drosophila_2:1629762_at:463:343; Interrogation_Position=3502; Antisense; GCTTCTTCCTTCCATGTATGTACAA

Paste this into a BLAST search page for me
GGAACGGTGTACAGCATACTCGAGAATACTCGAGAATAATTCCGGTGACAGGTTTCATATTTCAGACCTATTTTTTATTAGGTTCATGTTTTGGTTGTACGTTTTGGTTGTACATGACGGATTTCTGACGGATTTCTTGGTGGTGTTAAAGGTGTTAAACACGTCCTTGCAAAAGGTTTAAGAGATTTATTCGCATTGCAAATTCTTGTGTGTCGAAGTTGTGCTAAGTTGTGCTTTAGTTCGTTTCCATGTTCGTTTCCATGAAGTCTATCAAAAAGAGTGAAAATGGCGCGTCGAAAAAAACAGAAGCTTCTTCCTTCCATGTGCTTCTTCCTTCCATGTATGTACAA

Full Affymetrix probeset data:

Annotations for 1629762_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720