FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629763_at:

>probe:Drosophila_2:1629763_at:694:283; Interrogation_Position=1625; Antisense; CTGCTTCTCATTCTGGCCAAGATGA
>probe:Drosophila_2:1629763_at:512:437; Interrogation_Position=1658; Antisense; GAGGCGATACTTGACCAGGTCGAAT
>probe:Drosophila_2:1629763_at:236:79; Interrogation_Position=1674; Antisense; AGGTCGAATGGTCAGCGCTGCTCTT
>probe:Drosophila_2:1629763_at:155:31; Interrogation_Position=1734; Antisense; ATAAATTGGGCTTCATTCGCTGGCT
>probe:Drosophila_2:1629763_at:407:473; Interrogation_Position=1800; Antisense; GTTATCAGACGACAGTGGCCATCCT
>probe:Drosophila_2:1629763_at:269:33; Interrogation_Position=1826; Antisense; ATAATCATCTGGATGTCCGCCATTC
>probe:Drosophila_2:1629763_at:229:513; Interrogation_Position=1877; Antisense; GTGACCACGATGCTGCTGAGACTGA
>probe:Drosophila_2:1629763_at:718:93; Interrogation_Position=1908; Antisense; AGTTGCACCGTAACGATGCCATCAG
>probe:Drosophila_2:1629763_at:225:647; Interrogation_Position=1950; Antisense; TCATTTGGGCTTTGTCATATGGCGC
>probe:Drosophila_2:1629763_at:156:273; Interrogation_Position=1965; Antisense; CATATGGCGCCTGTTTCGGTGGTAA
>probe:Drosophila_2:1629763_at:309:565; Interrogation_Position=2029; Antisense; GGCAATCGCCCAACAGTATGGCTAT
>probe:Drosophila_2:1629763_at:435:97; Interrogation_Position=2055; Antisense; AGATCTCCTTTGTGCAGTTCTTCAT
>probe:Drosophila_2:1629763_at:147:571; Interrogation_Position=2084; Antisense; GGCTTTCCCATGATGCTGACCAGTA
>probe:Drosophila_2:1629763_at:314:285; Interrogation_Position=2099; Antisense; CTGACCAGTATTTTTCTCGCAACGG

Paste this into a BLAST search page for me
CTGCTTCTCATTCTGGCCAAGATGAGAGGCGATACTTGACCAGGTCGAATAGGTCGAATGGTCAGCGCTGCTCTTATAAATTGGGCTTCATTCGCTGGCTGTTATCAGACGACAGTGGCCATCCTATAATCATCTGGATGTCCGCCATTCGTGACCACGATGCTGCTGAGACTGAAGTTGCACCGTAACGATGCCATCAGTCATTTGGGCTTTGTCATATGGCGCCATATGGCGCCTGTTTCGGTGGTAAGGCAATCGCCCAACAGTATGGCTATAGATCTCCTTTGTGCAGTTCTTCATGGCTTTCCCATGATGCTGACCAGTACTGACCAGTATTTTTCTCGCAACGG

Full Affymetrix probeset data:

Annotations for 1629763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720