FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629765_at:

>probe:Drosophila_2:1629765_at:333:693; Interrogation_Position=262; Antisense; TTTGTCCTCCAGAAGTGCGTGTCGC
>probe:Drosophila_2:1629765_at:204:685; Interrogation_Position=295; Antisense; TATATCCCAGCTCCCTCAATGGAAG
>probe:Drosophila_2:1629765_at:402:633; Interrogation_Position=336; Antisense; TCCCATCACCATGCAGGTTATCGAG
>probe:Drosophila_2:1629765_at:33:477; Interrogation_Position=352; Antisense; GTTATCGAGAATGCACCACCAGTGA
>probe:Drosophila_2:1629765_at:690:99; Interrogation_Position=396; Antisense; AGAGGCCGAGACTCCGGAGCACCAT
>probe:Drosophila_2:1629765_at:353:553; Interrogation_Position=411; Antisense; GGAGCACCATGAGCATCAGGAGCAC
>probe:Drosophila_2:1629765_at:227:35; Interrogation_Position=425; Antisense; ATCAGGAGCACCACGAGCATAATGA
>probe:Drosophila_2:1629765_at:613:547; Interrogation_Position=450; Antisense; GGAGGAGGTTGAGGCACACCCCATC
>probe:Drosophila_2:1629765_at:715:719; Interrogation_Position=515; Antisense; TTGCTATTAAGCCAGCTGTGCCCGT
>probe:Drosophila_2:1629765_at:196:505; Interrogation_Position=538; Antisense; GTGCCCGGCAAGAAGGTCACGGTCC
>probe:Drosophila_2:1629765_at:228:377; Interrogation_Position=702; Antisense; GAAGAAGCCAGCCACCGCTTAAATC
>probe:Drosophila_2:1629765_at:338:43; Interrogation_Position=736; Antisense; ATCCTAACCAAGATCGCCAGTTCAA
>probe:Drosophila_2:1629765_at:670:233; Interrogation_Position=759; Antisense; AATGCCCATCTTTCAGCAAGCGGAA
>probe:Drosophila_2:1629765_at:273:331; Interrogation_Position=778; Antisense; GCGGAATTTCATTCACTACTCTAAA

Paste this into a BLAST search page for me
TTTGTCCTCCAGAAGTGCGTGTCGCTATATCCCAGCTCCCTCAATGGAAGTCCCATCACCATGCAGGTTATCGAGGTTATCGAGAATGCACCACCAGTGAAGAGGCCGAGACTCCGGAGCACCATGGAGCACCATGAGCATCAGGAGCACATCAGGAGCACCACGAGCATAATGAGGAGGAGGTTGAGGCACACCCCATCTTGCTATTAAGCCAGCTGTGCCCGTGTGCCCGGCAAGAAGGTCACGGTCCGAAGAAGCCAGCCACCGCTTAAATCATCCTAACCAAGATCGCCAGTTCAAAATGCCCATCTTTCAGCAAGCGGAAGCGGAATTTCATTCACTACTCTAAA

Full Affymetrix probeset data:

Annotations for 1629765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720