FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629766_at:

>probe:Drosophila_2:1629766_at:29:447; Interrogation_Position=6021; Antisense; GATCCTGGATCCTCTGAAATTTCGT
>probe:Drosophila_2:1629766_at:89:397; Interrogation_Position=6036; Antisense; GAAATTTCGTTCAACACGCATCAGT
>probe:Drosophila_2:1629766_at:181:131; Interrogation_Position=6051; Antisense; ACGCATCAGTTGAGGGCCCGTCTGT
>probe:Drosophila_2:1629766_at:613:577; Interrogation_Position=6065; Antisense; GGCCCGTCTGTCTTGTTTAATATGT
>probe:Drosophila_2:1629766_at:109:61; Interrogation_Position=6086; Antisense; ATGTTTCGTTATGAGTTCTGACCTA
>probe:Drosophila_2:1629766_at:705:715; Interrogation_Position=6101; Antisense; TTCTGACCTAGAACCGAGGACTGCC
>probe:Drosophila_2:1629766_at:579:271; Interrogation_Position=6181; Antisense; CATCTTCCCTTACATTTTTACGCGT
>probe:Drosophila_2:1629766_at:84:25; Interrogation_Position=6218; Antisense; ATACCATAATTGTTGTTTGCGGTTA
>probe:Drosophila_2:1629766_at:166:257; Interrogation_Position=6252; Antisense; CAAATGCTTTTTACAGCGCTGTTAT
>probe:Drosophila_2:1629766_at:274:493; Interrogation_Position=6326; Antisense; GTAACGCTTTGTTTGCCATTGGCCA
>probe:Drosophila_2:1629766_at:417:313; Interrogation_Position=6347; Antisense; GCCACGCCTGCTTTTATTTGTTTAC
>probe:Drosophila_2:1629766_at:631:491; Interrogation_Position=6408; Antisense; GTAATCCAAAACTGCTCATCGAACA
>probe:Drosophila_2:1629766_at:148:141; Interrogation_Position=6438; Antisense; ACGGAGGCTGCAGGATATACACATG
>probe:Drosophila_2:1629766_at:464:293; Interrogation_Position=6498; Antisense; CGATATTCAGCTTGTGATTTGCAAT

Paste this into a BLAST search page for me
GATCCTGGATCCTCTGAAATTTCGTGAAATTTCGTTCAACACGCATCAGTACGCATCAGTTGAGGGCCCGTCTGTGGCCCGTCTGTCTTGTTTAATATGTATGTTTCGTTATGAGTTCTGACCTATTCTGACCTAGAACCGAGGACTGCCCATCTTCCCTTACATTTTTACGCGTATACCATAATTGTTGTTTGCGGTTACAAATGCTTTTTACAGCGCTGTTATGTAACGCTTTGTTTGCCATTGGCCAGCCACGCCTGCTTTTATTTGTTTACGTAATCCAAAACTGCTCATCGAACAACGGAGGCTGCAGGATATACACATGCGATATTCAGCTTGTGATTTGCAAT

Full Affymetrix probeset data:

Annotations for 1629766_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720