FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629769_at:

>probe:Drosophila_2:1629769_at:609:465; Interrogation_Position=1007; Antisense; GATTGATAATGCACCAGTTCCACGA
>probe:Drosophila_2:1629769_at:524:223; Interrogation_Position=448; Antisense; AAGGTGAACTGCCTGTGCCGCAACT
>probe:Drosophila_2:1629769_at:172:391; Interrogation_Position=485; Antisense; GAAACGCGTTCTGCATCGAAAACTT
>probe:Drosophila_2:1629769_at:282:189; Interrogation_Position=511; Antisense; AACATGGCCAGGTGGATCTTGCTGC
>probe:Drosophila_2:1629769_at:19:339; Interrogation_Position=556; Antisense; GCTCACCTGGCCAAAGCTGATGACA
>probe:Drosophila_2:1629769_at:661:333; Interrogation_Position=577; Antisense; GACAACTTTACGGACTTTGACTTCG
>probe:Drosophila_2:1629769_at:451:263; Interrogation_Position=613; Antisense; CAGCTGCTGCAAATGTCTGATTTCG
>probe:Drosophila_2:1629769_at:689:245; Interrogation_Position=661; Antisense; AATTCAACGGAATTCGACGTGGCCA
>probe:Drosophila_2:1629769_at:81:523; Interrogation_Position=737; Antisense; GTGGCCAGCGCGAACCTATATTCGA
>probe:Drosophila_2:1629769_at:363:147; Interrogation_Position=782; Antisense; ACTTTGGGCGCTTCATCTTCATGGT
>probe:Drosophila_2:1629769_at:575:647; Interrogation_Position=794; Antisense; TCATCTTCATGGTTCTGCTGCTGCA
>probe:Drosophila_2:1629769_at:138:129; Interrogation_Position=844; Antisense; ACCATCTATAGCTGTGTGCACTGCA
>probe:Drosophila_2:1629769_at:410:123; Interrogation_Position=908; Antisense; AGCGACGGCTGCAGATGACCAATCT
>probe:Drosophila_2:1629769_at:137:127; Interrogation_Position=925; Antisense; ACCAATCTGCGGTCGAATCACATTC

Paste this into a BLAST search page for me
GATTGATAATGCACCAGTTCCACGAAAGGTGAACTGCCTGTGCCGCAACTGAAACGCGTTCTGCATCGAAAACTTAACATGGCCAGGTGGATCTTGCTGCGCTCACCTGGCCAAAGCTGATGACAGACAACTTTACGGACTTTGACTTCGCAGCTGCTGCAAATGTCTGATTTCGAATTCAACGGAATTCGACGTGGCCAGTGGCCAGCGCGAACCTATATTCGAACTTTGGGCGCTTCATCTTCATGGTTCATCTTCATGGTTCTGCTGCTGCAACCATCTATAGCTGTGTGCACTGCAAGCGACGGCTGCAGATGACCAATCTACCAATCTGCGGTCGAATCACATTC

Full Affymetrix probeset data:

Annotations for 1629769_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720