Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629772_at:

>probe:Drosophila_2:1629772_at:674:683; Interrogation_Position=1161; Antisense; TATCCTGCTGGATTGCTCAAAACTT
>probe:Drosophila_2:1629772_at:675:677; Interrogation_Position=1205; Antisense; TAGATGATACGGTTTCCTCCTTTCG
>probe:Drosophila_2:1629772_at:729:499; Interrogation_Position=1232; Antisense; GTCGCTTGGAACTCTTTCGTGAGCA
>probe:Drosophila_2:1629772_at:233:283; Interrogation_Position=1261; Antisense; CTGCCCATGCTCAAGATTCTGGATA
>probe:Drosophila_2:1629772_at:32:505; Interrogation_Position=1325; Antisense; GTCCATCAGTGCAGCGCGAATTCGA
>probe:Drosophila_2:1629772_at:287:247; Interrogation_Position=1343; Antisense; AATTCGAGCGTCTCATCCGGAATCA
>probe:Drosophila_2:1629772_at:228:565; Interrogation_Position=1361; Antisense; GGAATCACATCCAGCGTTTGTTGAA
>probe:Drosophila_2:1629772_at:368:663; Interrogation_Position=1398; Antisense; TATAGACGACTCAGCCAACTTGGGT
>probe:Drosophila_2:1629772_at:327:197; Interrogation_Position=1446; Antisense; AACGGATGCCATTCTACACGATCTG
>probe:Drosophila_2:1629772_at:20:589; Interrogation_Position=1469; Antisense; TGGAGACCAATGTGCCAGGCGCCGT
>probe:Drosophila_2:1629772_at:508:505; Interrogation_Position=1492; Antisense; GTGCCCACAATTAGTCACCACGTGA
>probe:Drosophila_2:1629772_at:305:389; Interrogation_Position=1565; Antisense; GAAAACCCCACGGTCAGATGATGAA
>probe:Drosophila_2:1629772_at:524:443; Interrogation_Position=1584; Antisense; GATGAACGGACATGTTCCCGGCAGA
>probe:Drosophila_2:1629772_at:513:437; Interrogation_Position=1666; Antisense; GAGGCCGAGCGATATCCGGTCGACT

Paste this into a BLAST search page for me
TATCCTGCTGGATTGCTCAAAACTTTAGATGATACGGTTTCCTCCTTTCGGTCGCTTGGAACTCTTTCGTGAGCACTGCCCATGCTCAAGATTCTGGATAGTCCATCAGTGCAGCGCGAATTCGAAATTCGAGCGTCTCATCCGGAATCAGGAATCACATCCAGCGTTTGTTGAATATAGACGACTCAGCCAACTTGGGTAACGGATGCCATTCTACACGATCTGTGGAGACCAATGTGCCAGGCGCCGTGTGCCCACAATTAGTCACCACGTGAGAAAACCCCACGGTCAGATGATGAAGATGAACGGACATGTTCCCGGCAGAGAGGCCGAGCGATATCCGGTCGACT

Full Affymetrix probeset data:

Annotations for 1629772_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime