FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629773_at:

>probe:Drosophila_2:1629773_at:555:501; Interrogation_Position=109; Antisense; GTCGATGCCAATTTGCTGCATCCGG
>probe:Drosophila_2:1629773_at:309:47; Interrogation_Position=128; Antisense; ATCCGGTTCACGATGTCATAGTCAA
>probe:Drosophila_2:1629773_at:211:415; Interrogation_Position=15; Antisense; GACCAATGCAGTATGTGAGACCTAT
>probe:Drosophila_2:1629773_at:591:31; Interrogation_Position=182; Antisense; ATAAGCCTTGGCTATATAGCGTCAG
>probe:Drosophila_2:1629773_at:366:27; Interrogation_Position=197; Antisense; ATAGCGTCAGTTTCGACGGCTGTCA
>probe:Drosophila_2:1629773_at:576:405; Interrogation_Position=211; Antisense; GACGGCTGTCAGTTTATAAGGCGGA
>probe:Drosophila_2:1629773_at:628:393; Interrogation_Position=236; Antisense; GAAATAATGCCTTGATTCGGATCGT
>probe:Drosophila_2:1629773_at:616:9; Interrogation_Position=250; Antisense; ATTCGGATCGTTTGGGAGCTCTTCA
>probe:Drosophila_2:1629773_at:522:307; Interrogation_Position=305; Antisense; CCTATGTGGGCCTGCAGCAAGTCAA
>probe:Drosophila_2:1629773_at:655:251; Interrogation_Position=327; Antisense; CAAGAACTTCTATCTCAGGTCCGAG
>probe:Drosophila_2:1629773_at:617:719; Interrogation_Position=368; Antisense; TTCCCACTGGAGAATATCTGCTGAT
>probe:Drosophila_2:1629773_at:712:473; Interrogation_Position=405; Antisense; GTTCAACAAGAAACCGCAGGCTGCC
>probe:Drosophila_2:1629773_at:371:349; Interrogation_Position=420; Antisense; GCAGGCTGCCACAAATGTTTACTTC
>probe:Drosophila_2:1629773_at:345:223; Interrogation_Position=94; Antisense; AAGGTTTGCCTCAATGTCGATGCCA

Paste this into a BLAST search page for me
GTCGATGCCAATTTGCTGCATCCGGATCCGGTTCACGATGTCATAGTCAAGACCAATGCAGTATGTGAGACCTATATAAGCCTTGGCTATATAGCGTCAGATAGCGTCAGTTTCGACGGCTGTCAGACGGCTGTCAGTTTATAAGGCGGAGAAATAATGCCTTGATTCGGATCGTATTCGGATCGTTTGGGAGCTCTTCACCTATGTGGGCCTGCAGCAAGTCAACAAGAACTTCTATCTCAGGTCCGAGTTCCCACTGGAGAATATCTGCTGATGTTCAACAAGAAACCGCAGGCTGCCGCAGGCTGCCACAAATGTTTACTTCAAGGTTTGCCTCAATGTCGATGCCA

Full Affymetrix probeset data:

Annotations for 1629773_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720