FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629777_at:

>probe:Drosophila_2:1629777_at:241:83; Interrogation_Position=1026; Antisense; AGTGACCCAAGGTGCACAGGTGACA
>probe:Drosophila_2:1629777_at:427:519; Interrogation_Position=1076; Antisense; GTGGATTCTGTCGACATGACCGATT
>probe:Drosophila_2:1629777_at:120:277; Interrogation_Position=643; Antisense; CTTCAAGGGAGATCTCGCCCAGATT
>probe:Drosophila_2:1629777_at:700:119; Interrogation_Position=672; Antisense; AGCTGGTGCGCAACATGCAGAGCCA
>probe:Drosophila_2:1629777_at:427:617; Interrogation_Position=687; Antisense; TGCAGAGCCAGAATGTCCAGCTGAA
>probe:Drosophila_2:1629777_at:461:727; Interrogation_Position=734; Antisense; TTGGACCTCATCCTGGTGCCGAAAA
>probe:Drosophila_2:1629777_at:411:177; Interrogation_Position=756; Antisense; AAACGTGGAGTGGACGCGGTCTCCT
>probe:Drosophila_2:1629777_at:383:321; Interrogation_Position=802; Antisense; GCCCGAGGCGATGGATCACTGATGT
>probe:Drosophila_2:1629777_at:517:207; Interrogation_Position=839; Antisense; AAGCTTTTTTCGAGTTGCCTGTGCA
>probe:Drosophila_2:1629777_at:214:617; Interrogation_Position=873; Antisense; TGCACTTTAGTTATCAGCCCATCTC
>probe:Drosophila_2:1629777_at:116:71; Interrogation_Position=902; Antisense; AGGCCGACGAACATGGTTGCTCCAA
>probe:Drosophila_2:1629777_at:349:587; Interrogation_Position=945; Antisense; TGGACGCGATTTCAGGGCAATTTCA
>probe:Drosophila_2:1629777_at:31:527; Interrogation_Position=959; Antisense; GGGCAATTTCAGCTGGAGTCATCTC
>probe:Drosophila_2:1629777_at:326:431; Interrogation_Position=974; Antisense; GAGTCATCTCGCTGACTGACAGCCG

Paste this into a BLAST search page for me
AGTGACCCAAGGTGCACAGGTGACAGTGGATTCTGTCGACATGACCGATTCTTCAAGGGAGATCTCGCCCAGATTAGCTGGTGCGCAACATGCAGAGCCATGCAGAGCCAGAATGTCCAGCTGAATTGGACCTCATCCTGGTGCCGAAAAAAACGTGGAGTGGACGCGGTCTCCTGCCCGAGGCGATGGATCACTGATGTAAGCTTTTTTCGAGTTGCCTGTGCATGCACTTTAGTTATCAGCCCATCTCAGGCCGACGAACATGGTTGCTCCAATGGACGCGATTTCAGGGCAATTTCAGGGCAATTTCAGCTGGAGTCATCTCGAGTCATCTCGCTGACTGACAGCCG

Full Affymetrix probeset data:

Annotations for 1629777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720