FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629780_at:

>probe:Drosophila_2:1629780_at:216:425; Interrogation_Position=428; Antisense; GAGACGATTGAGCTCCGATCCGGAA
>probe:Drosophila_2:1629780_at:481:47; Interrogation_Position=445; Antisense; ATCCGGAAGTGATCAACCGTCCTTA
>probe:Drosophila_2:1629780_at:444:423; Interrogation_Position=486; Antisense; GAGAACTTCACTCTTATCGAACCTA
>probe:Drosophila_2:1629780_at:109:395; Interrogation_Position=540; Antisense; GAAATGACTCGACTGATCACGGAAT
>probe:Drosophila_2:1629780_at:675:77; Interrogation_Position=571; Antisense; AGGATCTAGAAAATTCTCGCCCCTC
>probe:Drosophila_2:1629780_at:129:213; Interrogation_Position=611; Antisense; AAGACGCCGTAATCGCATGCGGGCA
>probe:Drosophila_2:1629780_at:112:569; Interrogation_Position=632; Antisense; GGCAGATGGCATAGCTCGAGCTCAT
>probe:Drosophila_2:1629780_at:729:49; Interrogation_Position=655; Antisense; ATGCCCGACTTCATGCTCGAAGGAT
>probe:Drosophila_2:1629780_at:498:45; Interrogation_Position=689; Antisense; ATCCTTACACCGAGCTGCTTTGAGT
>probe:Drosophila_2:1629780_at:692:165; Interrogation_Position=739; Antisense; AAATCGCTCAAGATCTGCCGCGGGC
>probe:Drosophila_2:1629780_at:121:393; Interrogation_Position=832; Antisense; GAAAGCCTACTGTTCCAAGTCATCT
>probe:Drosophila_2:1629780_at:498:497; Interrogation_Position=850; Antisense; GTCATCTCTCCGAATGGTTGTATCC
>probe:Drosophila_2:1629780_at:92:543; Interrogation_Position=865; Antisense; GGTTGTATCCCATTTAAGCTGTAAA
>probe:Drosophila_2:1629780_at:343:89; Interrogation_Position=910; Antisense; AGTCATTGTTCTGTCGGACTCACAG

Paste this into a BLAST search page for me
GAGACGATTGAGCTCCGATCCGGAAATCCGGAAGTGATCAACCGTCCTTAGAGAACTTCACTCTTATCGAACCTAGAAATGACTCGACTGATCACGGAATAGGATCTAGAAAATTCTCGCCCCTCAAGACGCCGTAATCGCATGCGGGCAGGCAGATGGCATAGCTCGAGCTCATATGCCCGACTTCATGCTCGAAGGATATCCTTACACCGAGCTGCTTTGAGTAAATCGCTCAAGATCTGCCGCGGGCGAAAGCCTACTGTTCCAAGTCATCTGTCATCTCTCCGAATGGTTGTATCCGGTTGTATCCCATTTAAGCTGTAAAAGTCATTGTTCTGTCGGACTCACAG

Full Affymetrix probeset data:

Annotations for 1629780_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720