Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629787_at:

>probe:Drosophila_2:1629787_at:543:101; Interrogation_Position=1376; Antisense; AGAGCTGTTCCAGCCGCCAATTGGA
>probe:Drosophila_2:1629787_at:256:143; Interrogation_Position=1400; Antisense; ACTGCCCTGGACTGCGAATTTCATG
>probe:Drosophila_2:1629787_at:169:365; Interrogation_Position=1415; Antisense; GAATTTCATGTTGGACGCAGTCGAG
>probe:Drosophila_2:1629787_at:250:349; Interrogation_Position=1431; Antisense; GCAGTCGAGCCATCAGGCAGTGTAA
>probe:Drosophila_2:1629787_at:697:147; Interrogation_Position=1469; Antisense; ACTATTGCTGTATCCTGTTAAGACC
>probe:Drosophila_2:1629787_at:113:537; Interrogation_Position=1521; Antisense; GGTCTCGCCGAGTACAAAACTTGGA
>probe:Drosophila_2:1629787_at:310:103; Interrogation_Position=1555; Antisense; AGACCGAACCAACTGCCGAAAGCAA
>probe:Drosophila_2:1629787_at:340:391; Interrogation_Position=1572; Antisense; GAAAGCAAGGCAACTGAACTCCCAT
>probe:Drosophila_2:1629787_at:295:119; Interrogation_Position=1608; Antisense; AGCTCGGCTTATTTCACAGTTTTGG
>probe:Drosophila_2:1629787_at:123:457; Interrogation_Position=1635; Antisense; GATATCCCATATGCGGATTCCGGAT
>probe:Drosophila_2:1629787_at:14:157; Interrogation_Position=1720; Antisense; ACAGCGATGATTTAGCCGGATTGGA
>probe:Drosophila_2:1629787_at:223:717; Interrogation_Position=1796; Antisense; TTCGGATTCCGATTTCTCTGAGTCA
>probe:Drosophila_2:1629787_at:479:431; Interrogation_Position=1815; Antisense; GAGTCAGCCATTTCTCAAATCACCG
>probe:Drosophila_2:1629787_at:632:525; Interrogation_Position=1875; Antisense; GGGCACCCAGCATTTGTAGGAAATA

Paste this into a BLAST search page for me
AGAGCTGTTCCAGCCGCCAATTGGAACTGCCCTGGACTGCGAATTTCATGGAATTTCATGTTGGACGCAGTCGAGGCAGTCGAGCCATCAGGCAGTGTAAACTATTGCTGTATCCTGTTAAGACCGGTCTCGCCGAGTACAAAACTTGGAAGACCGAACCAACTGCCGAAAGCAAGAAAGCAAGGCAACTGAACTCCCATAGCTCGGCTTATTTCACAGTTTTGGGATATCCCATATGCGGATTCCGGATACAGCGATGATTTAGCCGGATTGGATTCGGATTCCGATTTCTCTGAGTCAGAGTCAGCCATTTCTCAAATCACCGGGGCACCCAGCATTTGTAGGAAATA

Full Affymetrix probeset data:

Annotations for 1629787_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime