FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629788_at:

>probe:Drosophila_2:1629788_at:468:707; Interrogation_Position=1001; Antisense; TTAACTGTGCCGAGTCCACCAACTT
>probe:Drosophila_2:1629788_at:254:149; Interrogation_Position=1022; Antisense; ACTTTGCCATGGAGCGCTGGATCGA
>probe:Drosophila_2:1629788_at:567:85; Interrogation_Position=1067; Antisense; AGTGCACCTGCAGCAACGATATGGT
>probe:Drosophila_2:1629788_at:314:399; Interrogation_Position=1105; Antisense; GACACATTTGTCAAGCGCTTCCAAA
>probe:Drosophila_2:1629788_at:474:151; Interrogation_Position=1224; Antisense; ACATCTCGATGTCTTGCTGTGTGAT
>probe:Drosophila_2:1629788_at:473:111; Interrogation_Position=1262; Antisense; AGCAATGCAATCCTACCAAGGCCAA
>probe:Drosophila_2:1629788_at:472:1; Interrogation_Position=1286; Antisense; AGAGTTTCAAAGAGCGTAATCCCGA
>probe:Drosophila_2:1629788_at:216:491; Interrogation_Position=1301; Antisense; GTAATCCCGATCTGGACCTGGATGA
>probe:Drosophila_2:1629788_at:307:55; Interrogation_Position=1415; Antisense; ATGAGGCTGATTTTCCCAACGAGGA
>probe:Drosophila_2:1629788_at:415:607; Interrogation_Position=1445; Antisense; TGAGTCTACAGAGTCCGGCGAATCT
>probe:Drosophila_2:1629788_at:497:553; Interrogation_Position=1482; Antisense; GGAGCTGCTTGAGTACATTGACGAC
>probe:Drosophila_2:1629788_at:620:489; Interrogation_Position=1494; Antisense; GTACATTGACGACGGCACAGCTTAA
>probe:Drosophila_2:1629788_at:1:455; Interrogation_Position=951; Antisense; GATCATGATCACATTTCCGTTCGGC
>probe:Drosophila_2:1629788_at:232:287; Interrogation_Position=984; Antisense; CGGCTTCAATCACGGCTTTAACTGT

Paste this into a BLAST search page for me
TTAACTGTGCCGAGTCCACCAACTTACTTTGCCATGGAGCGCTGGATCGAAGTGCACCTGCAGCAACGATATGGTGACACATTTGTCAAGCGCTTCCAAAACATCTCGATGTCTTGCTGTGTGATAGCAATGCAATCCTACCAAGGCCAAAGAGTTTCAAAGAGCGTAATCCCGAGTAATCCCGATCTGGACCTGGATGAATGAGGCTGATTTTCCCAACGAGGATGAGTCTACAGAGTCCGGCGAATCTGGAGCTGCTTGAGTACATTGACGACGTACATTGACGACGGCACAGCTTAAGATCATGATCACATTTCCGTTCGGCCGGCTTCAATCACGGCTTTAACTGT

Full Affymetrix probeset data:

Annotations for 1629788_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720