Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629789_at:

>probe:Drosophila_2:1629789_at:619:693; Interrogation_Position=1116; Antisense; TTTCGTCGGGAGCTACACTAGGTGT
>probe:Drosophila_2:1629789_at:111:487; Interrogation_Position=1139; Antisense; GTAGCGCGACTATTAATCCACGAAC
>probe:Drosophila_2:1629789_at:87:237; Interrogation_Position=1169; Antisense; AATCCCAATGTATACACCGATGCGG
>probe:Drosophila_2:1629789_at:680:293; Interrogation_Position=1186; Antisense; CGATGCGGATTTAGCACTGCTCCAG
>probe:Drosophila_2:1629789_at:328:143; Interrogation_Position=1201; Antisense; ACTGCTCCAGTTGTCTAATCACGTT
>probe:Drosophila_2:1629789_at:543:727; Interrogation_Position=1230; Antisense; TTGGCGATTACATCAAGCCCATCTG
>probe:Drosophila_2:1629789_at:249:125; Interrogation_Position=1245; Antisense; AGCCCATCTGTTTGTGGAACGAGAA
>probe:Drosophila_2:1629789_at:606:421; Interrogation_Position=1265; Antisense; GAGAACTTTTTGCTCGAACTGCCCT
>probe:Drosophila_2:1629789_at:494:537; Interrogation_Position=1292; Antisense; GGTCACAAGTCCTATGTGGCTGGTT
>probe:Drosophila_2:1629789_at:479:561; Interrogation_Position=1335; Antisense; GGAACCGAAACACGCGACTGGCCAA
>probe:Drosophila_2:1629789_at:186:107; Interrogation_Position=1416; Antisense; AGAACGCCAAGTTTATCACCTCGCA
>probe:Drosophila_2:1629789_at:451:9; Interrogation_Position=1488; Antisense; ATTCCGGTGGTGGACTGATGCTCCA
>probe:Drosophila_2:1629789_at:147:411; Interrogation_Position=1582; Antisense; GACGCTGCCTGTCATCTATACGGAT
>probe:Drosophila_2:1629789_at:567:151; Interrogation_Position=1617; Antisense; ACATCGAGTGGCTGCTCAGTAGCAT

Paste this into a BLAST search page for me
TTTCGTCGGGAGCTACACTAGGTGTGTAGCGCGACTATTAATCCACGAACAATCCCAATGTATACACCGATGCGGCGATGCGGATTTAGCACTGCTCCAGACTGCTCCAGTTGTCTAATCACGTTTTGGCGATTACATCAAGCCCATCTGAGCCCATCTGTTTGTGGAACGAGAAGAGAACTTTTTGCTCGAACTGCCCTGGTCACAAGTCCTATGTGGCTGGTTGGAACCGAAACACGCGACTGGCCAAAGAACGCCAAGTTTATCACCTCGCAATTCCGGTGGTGGACTGATGCTCCAGACGCTGCCTGTCATCTATACGGATACATCGAGTGGCTGCTCAGTAGCAT

Full Affymetrix probeset data:

Annotations for 1629789_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime