FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629790_at:

>probe:Drosophila_2:1629790_at:520:169; Interrogation_Position=116; Antisense; AAATGGCCGCCGCTATCAAGAAGAT
>probe:Drosophila_2:1629790_at:547:347; Interrogation_Position=13; Antisense; GCAGTCCCGCATCTAGCGAGAATAG
>probe:Drosophila_2:1629790_at:296:357; Interrogation_Position=230; Antisense; GCAAAGTACTTGAGGGCACCGTTCT
>probe:Drosophila_2:1629790_at:676:201; Interrogation_Position=292; Antisense; AACCACATTCCCATTGGCGTGAAGG
>probe:Drosophila_2:1629790_at:593:327; Interrogation_Position=320; Antisense; GCGATCGTGTTCTGCTGCCCGAATT
>probe:Drosophila_2:1629790_at:157:625; Interrogation_Position=335; Antisense; TGCCCGAATTCGGTGGCACCAAGGT
>probe:Drosophila_2:1629790_at:268:679; Interrogation_Position=35; Antisense; TAGTTACGCCGGCACGTGTAGTTGA
>probe:Drosophila_2:1629790_at:713:511; Interrogation_Position=371; Antisense; GTGACCAGAAGGAGCTGTTCCTCTT
>probe:Drosophila_2:1629790_at:61:249; Interrogation_Position=419; Antisense; AATTGGAGTAGATCTCGCCTCCGGA
>probe:Drosophila_2:1629790_at:112:559; Interrogation_Position=441; Antisense; GGACACTGTCTCACAATTCTATGAA
>probe:Drosophila_2:1629790_at:448:675; Interrogation_Position=481; Antisense; TAGTATGTAACACACCCACAAACCC
>probe:Drosophila_2:1629790_at:512:693; Interrogation_Position=546; Antisense; TTTGCATTGCGCATGGACCGTCATT
>probe:Drosophila_2:1629790_at:117:259; Interrogation_Position=74; Antisense; CATTAACTTTTATCAACCGCTCCAG
>probe:Drosophila_2:1629790_at:277:201; Interrogation_Position=88; Antisense; AACCGCTCCAGTTTGCATTTAAGAA

Paste this into a BLAST search page for me
AAATGGCCGCCGCTATCAAGAAGATGCAGTCCCGCATCTAGCGAGAATAGGCAAAGTACTTGAGGGCACCGTTCTAACCACATTCCCATTGGCGTGAAGGGCGATCGTGTTCTGCTGCCCGAATTTGCCCGAATTCGGTGGCACCAAGGTTAGTTACGCCGGCACGTGTAGTTGAGTGACCAGAAGGAGCTGTTCCTCTTAATTGGAGTAGATCTCGCCTCCGGAGGACACTGTCTCACAATTCTATGAATAGTATGTAACACACCCACAAACCCTTTGCATTGCGCATGGACCGTCATTCATTAACTTTTATCAACCGCTCCAGAACCGCTCCAGTTTGCATTTAAGAA

Full Affymetrix probeset data:

Annotations for 1629790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720