FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629792_at:

>probe:Drosophila_2:1629792_at:329:395; Interrogation_Position=1079; Antisense; GAAATAATTGTTCAGCTCGTTTTGA
>probe:Drosophila_2:1629792_at:377:303; Interrogation_Position=1127; Antisense; CCGATTTGCGATAAAAGGGCGTAGT
>probe:Drosophila_2:1629792_at:227:221; Interrogation_Position=1141; Antisense; AAGGGCGTAGTAACATCAACTGCAA
>probe:Drosophila_2:1629792_at:145:475; Interrogation_Position=1244; Antisense; GTTACTTGAATTAGGTCACAACGCT
>probe:Drosophila_2:1629792_at:697:655; Interrogation_Position=1255; Antisense; TAGGTCACAACGCTACTTTTTACAG
>probe:Drosophila_2:1629792_at:198:341; Interrogation_Position=1266; Antisense; GCTACTTTTTACAGCTTATTGTCTA
>probe:Drosophila_2:1629792_at:158:373; Interrogation_Position=1332; Antisense; GAAGGTACAATATCACATCGTCCAC
>probe:Drosophila_2:1629792_at:386:33; Interrogation_Position=1343; Antisense; ATCACATCGTCCACAAGTAAATTGC
>probe:Drosophila_2:1629792_at:724:393; Interrogation_Position=1381; Antisense; GAAATGTTACAATGCCTTGCTAGTG
>probe:Drosophila_2:1629792_at:599:249; Interrogation_Position=1390; Antisense; CAATGCCTTGCTAGTGTTTATATAT
>probe:Drosophila_2:1629792_at:6:421; Interrogation_Position=931; Antisense; GAGCAGCGCTTAATCTTCATTTTAA
>probe:Drosophila_2:1629792_at:376:709; Interrogation_Position=952; Antisense; TTAAAACACTTCGTGCGTTCCTGGT
>probe:Drosophila_2:1629792_at:645:621; Interrogation_Position=965; Antisense; TGCGTTCCTGGTGCACTTAATGAAA
>probe:Drosophila_2:1629792_at:153:239; Interrogation_Position=999; Antisense; AATAATTTGCCGTTTTAAGTCATCA

Paste this into a BLAST search page for me
GAAATAATTGTTCAGCTCGTTTTGACCGATTTGCGATAAAAGGGCGTAGTAAGGGCGTAGTAACATCAACTGCAAGTTACTTGAATTAGGTCACAACGCTTAGGTCACAACGCTACTTTTTACAGGCTACTTTTTACAGCTTATTGTCTAGAAGGTACAATATCACATCGTCCACATCACATCGTCCACAAGTAAATTGCGAAATGTTACAATGCCTTGCTAGTGCAATGCCTTGCTAGTGTTTATATATGAGCAGCGCTTAATCTTCATTTTAATTAAAACACTTCGTGCGTTCCTGGTTGCGTTCCTGGTGCACTTAATGAAAAATAATTTGCCGTTTTAAGTCATCA

Full Affymetrix probeset data:

Annotations for 1629792_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720