FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629793_at:

>probe:Drosophila_2:1629793_at:669:277; Interrogation_Position=2499; Antisense; CTATCCGTGGCAGCGAAAAGTCCAA
>probe:Drosophila_2:1629793_at:349:183; Interrogation_Position=2514; Antisense; AAAAGTCCAACGCTGCGATCGGTGC
>probe:Drosophila_2:1629793_at:518:451; Interrogation_Position=2530; Antisense; GATCGGTGCGGTGCCTGCTTCCACA
>probe:Drosophila_2:1629793_at:636:257; Interrogation_Position=2551; Antisense; CACAACGGCTGCTGGAAGGTCAGGA
>probe:Drosophila_2:1629793_at:266:485; Interrogation_Position=2569; Antisense; GTCAGGAGTCGGTGTCGCAACCAAA
>probe:Drosophila_2:1629793_at:12:517; Interrogation_Position=2580; Antisense; GTGTCGCAACCAAAACGATCCTTGT
>probe:Drosophila_2:1629793_at:634:179; Interrogation_Position=2591; Antisense; AAAACGATCCTTGTCCCAGGTGCTC
>probe:Drosophila_2:1629793_at:678:505; Interrogation_Position=2630; Antisense; GTGCCAGCTAACATCCGATCAAAGA
>probe:Drosophila_2:1629793_at:150:679; Interrogation_Position=2691; Antisense; TAGTGAAATCCACTTTCGCCTCGGA
>probe:Drosophila_2:1629793_at:25:719; Interrogation_Position=2705; Antisense; TTCGCCTCGGAAACTGTATATACAA
>probe:Drosophila_2:1629793_at:644:715; Interrogation_Position=2789; Antisense; TTCGCATAGTTTTTAGAGTTAGGCC
>probe:Drosophila_2:1629793_at:239:21; Interrogation_Position=2865; Antisense; ATATAACATGTTGCTTTCCGTAAGT
>probe:Drosophila_2:1629793_at:495:73; Interrogation_Position=2915; Antisense; AGGATCCATTTGCTTCTAAACGAAA
>probe:Drosophila_2:1629793_at:405:389; Interrogation_Position=2953; Antisense; GAAACATCACTTATTTGCCTGGAAA

Paste this into a BLAST search page for me
CTATCCGTGGCAGCGAAAAGTCCAAAAAAGTCCAACGCTGCGATCGGTGCGATCGGTGCGGTGCCTGCTTCCACACACAACGGCTGCTGGAAGGTCAGGAGTCAGGAGTCGGTGTCGCAACCAAAGTGTCGCAACCAAAACGATCCTTGTAAAACGATCCTTGTCCCAGGTGCTCGTGCCAGCTAACATCCGATCAAAGATAGTGAAATCCACTTTCGCCTCGGATTCGCCTCGGAAACTGTATATACAATTCGCATAGTTTTTAGAGTTAGGCCATATAACATGTTGCTTTCCGTAAGTAGGATCCATTTGCTTCTAAACGAAAGAAACATCACTTATTTGCCTGGAAA

Full Affymetrix probeset data:

Annotations for 1629793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720