Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629794_at:

>probe:Drosophila_2:1629794_at:254:231; Interrogation_Position=2679; Antisense; AATGACACAGACCAGGATGCGCCCT
>probe:Drosophila_2:1629794_at:627:445; Interrogation_Position=2694; Antisense; GATGCGCCCTATTATCAGCGGCCGT
>probe:Drosophila_2:1629794_at:410:331; Interrogation_Position=2711; Antisense; GCGGCCGTCGAGCTATGACTACGAT
>probe:Drosophila_2:1629794_at:599:351; Interrogation_Position=2803; Antisense; GCAGCAATGGCTCCAACAACGGCAA
>probe:Drosophila_2:1629794_at:493:297; Interrogation_Position=2849; Antisense; CGCAGAGGCGGGTTCCATCGAAAAT
>probe:Drosophila_2:1629794_at:362:203; Interrogation_Position=2880; Antisense; AAGCCGGGTCGTGTACTCATGAAAC
>probe:Drosophila_2:1629794_at:496:125; Interrogation_Position=2946; Antisense; AGCCTCAACAGCGTTGGCGTGTAAT
>probe:Drosophila_2:1629794_at:64:329; Interrogation_Position=2962; Antisense; GCGTGTAATCGCAATCTCGTGATCT
>probe:Drosophila_2:1629794_at:342:513; Interrogation_Position=2980; Antisense; GTGATCTTTAGTCTGTGCATCCCTA
>probe:Drosophila_2:1629794_at:493:441; Interrogation_Position=3010; Antisense; GATGTACCATGCTATTCCTCTACCT
>probe:Drosophila_2:1629794_at:405:39; Interrogation_Position=3031; Antisense; ACCTCTGTTTTATCTACCACTTTGA
>probe:Drosophila_2:1629794_at:344:681; Interrogation_Position=3146; Antisense; TATGTCCATTCTACGCTAAGTCTTC
>probe:Drosophila_2:1629794_at:312:339; Interrogation_Position=3160; Antisense; GCTAAGTCTTCCATTTTTCGCGATA
>probe:Drosophila_2:1629794_at:596:115; Interrogation_Position=3239; Antisense; AGCTTGTAGCTTCACCTTTTAACCT

Paste this into a BLAST search page for me
AATGACACAGACCAGGATGCGCCCTGATGCGCCCTATTATCAGCGGCCGTGCGGCCGTCGAGCTATGACTACGATGCAGCAATGGCTCCAACAACGGCAACGCAGAGGCGGGTTCCATCGAAAATAAGCCGGGTCGTGTACTCATGAAACAGCCTCAACAGCGTTGGCGTGTAATGCGTGTAATCGCAATCTCGTGATCTGTGATCTTTAGTCTGTGCATCCCTAGATGTACCATGCTATTCCTCTACCTACCTCTGTTTTATCTACCACTTTGATATGTCCATTCTACGCTAAGTCTTCGCTAAGTCTTCCATTTTTCGCGATAAGCTTGTAGCTTCACCTTTTAACCT

Full Affymetrix probeset data:

Annotations for 1629794_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime