FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629795_at:

>probe:Drosophila_2:1629795_at:395:201; Interrogation_Position=4469; Antisense; AACCGCGACGGACAAGCAACAAGTA
>probe:Drosophila_2:1629795_at:697:391; Interrogation_Position=4500; Antisense; GAAACCATGGCTAAAAGAGTCTCGA
>probe:Drosophila_2:1629795_at:253:25; Interrogation_Position=4532; Antisense; ATATGATGGCATTCTCCGAAGGAGG
>probe:Drosophila_2:1629795_at:315:407; Interrogation_Position=4560; Antisense; GACGGAATGCTTTCAATGTTTTCTA
>probe:Drosophila_2:1629795_at:602:489; Interrogation_Position=4668; Antisense; GTAAATGTTTCCGACTTTTGGTGTG
>probe:Drosophila_2:1629795_at:516:403; Interrogation_Position=4680; Antisense; GACTTTTGGTGTGAACTATGCTTAA
>probe:Drosophila_2:1629795_at:71:675; Interrogation_Position=4755; Antisense; TACCTTACCATAAAGATGCGCATCT
>probe:Drosophila_2:1629795_at:99:37; Interrogation_Position=4776; Antisense; ATCTATATATGACTCGCGACGTTCG
>probe:Drosophila_2:1629795_at:183:411; Interrogation_Position=4803; Antisense; GACGCCCCTCGGTGAGTTGTGCATC
>probe:Drosophila_2:1629795_at:348:619; Interrogation_Position=4822; Antisense; TGCATCCTGCTTGGAGGCGGAGAAA
>probe:Drosophila_2:1629795_at:59:203; Interrogation_Position=4845; Antisense; AAGCTCAAACCTTTCTCAAGTTGGA
>probe:Drosophila_2:1629795_at:114:611; Interrogation_Position=4858; Antisense; TCTCAAGTTGGATCCTTCCCTGGGT
>probe:Drosophila_2:1629795_at:115:287; Interrogation_Position=4877; Antisense; CTGGGTCCTTCTGACTAAACACCAA
>probe:Drosophila_2:1629795_at:305:663; Interrogation_Position=4892; Antisense; TAAACACCAATTTCTCCAATCCCAA

Paste this into a BLAST search page for me
AACCGCGACGGACAAGCAACAAGTAGAAACCATGGCTAAAAGAGTCTCGAATATGATGGCATTCTCCGAAGGAGGGACGGAATGCTTTCAATGTTTTCTAGTAAATGTTTCCGACTTTTGGTGTGGACTTTTGGTGTGAACTATGCTTAATACCTTACCATAAAGATGCGCATCTATCTATATATGACTCGCGACGTTCGGACGCCCCTCGGTGAGTTGTGCATCTGCATCCTGCTTGGAGGCGGAGAAAAAGCTCAAACCTTTCTCAAGTTGGATCTCAAGTTGGATCCTTCCCTGGGTCTGGGTCCTTCTGACTAAACACCAATAAACACCAATTTCTCCAATCCCAA

Full Affymetrix probeset data:

Annotations for 1629795_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720