FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629797_at:

>probe:Drosophila_2:1629797_at:652:21; Interrogation_Position=1300; Antisense; ATATTTGCGAGTTAGCTACCAGACA
>probe:Drosophila_2:1629797_at:22:679; Interrogation_Position=1331; Antisense; TAGTGTAGTGCATTTCCGATACCCC
>probe:Drosophila_2:1629797_at:343:59; Interrogation_Position=1389; Antisense; ATGTACTTATGTCAGGCCAGGCGGT
>probe:Drosophila_2:1629797_at:700:639; Interrogation_Position=1440; Antisense; TCGGCATCTCCAGCAGTCGTAGATA
>probe:Drosophila_2:1629797_at:592:87; Interrogation_Position=1454; Antisense; AGTCGTAGATACCACGCAGCCAGTC
>probe:Drosophila_2:1629797_at:18:355; Interrogation_Position=1469; Antisense; GCAGCCAGTCTGTGTTCAATGATTC
>probe:Drosophila_2:1629797_at:664:513; Interrogation_Position=1480; Antisense; GTGTTCAATGATTCCACCAGCCAGG
>probe:Drosophila_2:1629797_at:294:129; Interrogation_Position=1495; Antisense; ACCAGCCAGGCATTTTGTTTCCAAT
>probe:Drosophila_2:1629797_at:615:479; Interrogation_Position=1540; Antisense; GTTTGCGGCTTTTGTTTCGCCAGTT
>probe:Drosophila_2:1629797_at:210:699; Interrogation_Position=1585; Antisense; TTTTTTAGCACAGCGAACGCGACTG
>probe:Drosophila_2:1629797_at:203:381; Interrogation_Position=1599; Antisense; GAACGCGACTGCTAACTGGAACTGT
>probe:Drosophila_2:1629797_at:22:151; Interrogation_Position=1636; Antisense; ACTTGGCCACGTGCATCTTATGAAT
>probe:Drosophila_2:1629797_at:102:199; Interrogation_Position=1753; Antisense; AACGATTTTTGCTTCGATTAGCGAG
>probe:Drosophila_2:1629797_at:137:385; Interrogation_Position=1779; Antisense; GAACTTTGTGCATTTTTTACGCGAA

Paste this into a BLAST search page for me
ATATTTGCGAGTTAGCTACCAGACATAGTGTAGTGCATTTCCGATACCCCATGTACTTATGTCAGGCCAGGCGGTTCGGCATCTCCAGCAGTCGTAGATAAGTCGTAGATACCACGCAGCCAGTCGCAGCCAGTCTGTGTTCAATGATTCGTGTTCAATGATTCCACCAGCCAGGACCAGCCAGGCATTTTGTTTCCAATGTTTGCGGCTTTTGTTTCGCCAGTTTTTTTTAGCACAGCGAACGCGACTGGAACGCGACTGCTAACTGGAACTGTACTTGGCCACGTGCATCTTATGAATAACGATTTTTGCTTCGATTAGCGAGGAACTTTGTGCATTTTTTACGCGAA

Full Affymetrix probeset data:

Annotations for 1629797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720