FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629799_at:

>probe:Drosophila_2:1629799_at:273:697; Interrogation_Position=181; Antisense; TTTAAATACATTGAGGCCCACTTCG
>probe:Drosophila_2:1629799_at:556:607; Interrogation_Position=192; Antisense; TGAGGCCCACTTCGGATCAAAGAGA
>probe:Drosophila_2:1629799_at:135:525; Interrogation_Position=225; Antisense; GGGCTATGACATTTTACGGATCTAC
>probe:Drosophila_2:1629799_at:64:445; Interrogation_Position=238; Antisense; TTACGGATCTACAGGGAAAACTTCT
>probe:Drosophila_2:1629799_at:440:527; Interrogation_Position=251; Antisense; GGGAAAACTTCTACTTTCACTATGA
>probe:Drosophila_2:1629799_at:278:31; Interrogation_Position=275; Antisense; ATAAAACTCGCATTATTGCCCTGGT
>probe:Drosophila_2:1629799_at:510:691; Interrogation_Position=319; Antisense; TTTGATCGTCGAATGAGCCGTGTTC
>probe:Drosophila_2:1629799_at:609:635; Interrogation_Position=327; Antisense; TCGAATGAGCCGTGTTCGCGTTCCA
>probe:Drosophila_2:1629799_at:546:327; Interrogation_Position=344; Antisense; GCGTTCCAGCTTATGGAGCAAGATT
>probe:Drosophila_2:1629799_at:170:177; Interrogation_Position=418; Antisense; AAACGAAAGGTAAGGCTGCCCACAT
>probe:Drosophila_2:1629799_at:171:625; Interrogation_Position=434; Antisense; TGCCCACATGGATGCGTTGCGTAGA
>probe:Drosophila_2:1629799_at:436:531; Interrogation_Position=576; Antisense; GGTGGTCACAATGGGTCCAAATCCC
>probe:Drosophila_2:1629799_at:207:257; Interrogation_Position=593; Antisense; CAAATCCCACCTTTATTGGCATCAT
>probe:Drosophila_2:1629799_at:628:571; Interrogation_Position=620; Antisense; GGCTAATGCCGACAAACTGCAGCAT

Paste this into a BLAST search page for me
TTTAAATACATTGAGGCCCACTTCGTGAGGCCCACTTCGGATCAAAGAGAGGGCTATGACATTTTACGGATCTACTTACGGATCTACAGGGAAAACTTCTGGGAAAACTTCTACTTTCACTATGAATAAAACTCGCATTATTGCCCTGGTTTTGATCGTCGAATGAGCCGTGTTCTCGAATGAGCCGTGTTCGCGTTCCAGCGTTCCAGCTTATGGAGCAAGATTAAACGAAAGGTAAGGCTGCCCACATTGCCCACATGGATGCGTTGCGTAGAGGTGGTCACAATGGGTCCAAATCCCCAAATCCCACCTTTATTGGCATCATGGCTAATGCCGACAAACTGCAGCAT

Full Affymetrix probeset data:

Annotations for 1629799_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720