FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629801_at:

>probe:Drosophila_2:1629801_at:117:309; Interrogation_Position=124; Antisense; CCATCACCCAGCATTGGAATCGGAA
>probe:Drosophila_2:1629801_at:438:237; Interrogation_Position=141; Antisense; AATCGGAATTGGTCATGGCTACGGT
>probe:Drosophila_2:1629801_at:231:393; Interrogation_Position=15; Antisense; GAAAGGACTGCTACTCATTACAATC
>probe:Drosophila_2:1629801_at:467:3; Interrogation_Position=180; Antisense; ATTGGGTCTAGGAATCGGGCACTAC
>probe:Drosophila_2:1629801_at:608:367; Interrogation_Position=191; Antisense; GAATCGGGCACTACGGAGGACTCTA
>probe:Drosophila_2:1629801_at:500:141; Interrogation_Position=203; Antisense; ACGGAGGACTCTACGGGCACGGCTA
>probe:Drosophila_2:1629801_at:230:593; Interrogation_Position=254; Antisense; TGGGATTGGGCTACCATGCACCCAT
>probe:Drosophila_2:1629801_at:249:409; Interrogation_Position=288; Antisense; GACGATCATCGGCAAAAGCTACTTG
>probe:Drosophila_2:1629801_at:668:253; Interrogation_Position=300; Antisense; CAAAAGCTACTTGGGCGGCTATGGC
>probe:Drosophila_2:1629801_at:709:13; Interrogation_Position=31; Antisense; ATTACAATCGCCTGCTTGACGACCT
>probe:Drosophila_2:1629801_at:163:69; Interrogation_Position=320; Antisense; ATGGCTATGGCCTCGGTCACGGATA
>probe:Drosophila_2:1629801_at:73:291; Interrogation_Position=333; Antisense; CGGTCACGGATATCTCGGAGGCTAC
>probe:Drosophila_2:1629801_at:722:63; Interrogation_Position=351; Antisense; AGGCTACGGCCATGGACTGTACGGA
>probe:Drosophila_2:1629801_at:379:669; Interrogation_Position=409; Antisense; TACGGACTGGGATATGGCTATGGCC

Paste this into a BLAST search page for me
CCATCACCCAGCATTGGAATCGGAAAATCGGAATTGGTCATGGCTACGGTGAAAGGACTGCTACTCATTACAATCATTGGGTCTAGGAATCGGGCACTACGAATCGGGCACTACGGAGGACTCTAACGGAGGACTCTACGGGCACGGCTATGGGATTGGGCTACCATGCACCCATGACGATCATCGGCAAAAGCTACTTGCAAAAGCTACTTGGGCGGCTATGGCATTACAATCGCCTGCTTGACGACCTATGGCTATGGCCTCGGTCACGGATACGGTCACGGATATCTCGGAGGCTACAGGCTACGGCCATGGACTGTACGGATACGGACTGGGATATGGCTATGGCC

Full Affymetrix probeset data:

Annotations for 1629801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720